%PDF-1.3 1 0 obj [/PDF /Text /ImageB /ImageC /ImageI] endobj 12 0 obj << /Length 688 /Filter /FlateDecode >> stream xUj1}1ieFJh^0Ѐ!i/zI[Z$99 B`"θ üK?ġ Y'&$L7ax7:bK&`k\LFdH:藘DJ$!y$)6nsb,m?NG+.en5x EJjTh#ppY 6M/}o'c;,U5Š#*r.bۺ*{{4۟xoe|yu@`uNmd؇'H_eԒ_dÛius]d1dͪ(5i`8-0iKO.+J5 D0TjrCF\~뒓aeJ .d4&5,78Q׃]5nZowjk2OO:n htFD^=NF;THaH~pK,by)؄&]5l&6kw[v<,1F;X#}jX䮷:a^z EM3=Eh1e^ƃl3#m5C,MGھcKƗDIaLKW P fyᗑqdbIotu=  endstream endobj 7 0 obj << /Border [0 0 0] /Subtype /Link /A << /URI (mailto:wwashmon@naiglobal.com) /IsMap false /Type /Action /S /URI >> /Type /Annot /Rect [78.223 367.237 208.375 377.637] >> endobj 2 0 obj << /Type /Page /Parent 13 0 R /MediaBox [0 0 612.0 792.0] /Contents 12 0 R /Annots [ 7 0 R ] /Resources << /ProcSet 1 0 R /XObject << /Im3 3 0 R /Im4 4 0 R /Im8 8 0 R /Im10 10 0 R /Im11 11 0 R >> /Font << /F5 5 0 R /F6 6 0 R /F9 9 0 R >> >> >> endobj 3 0 obj << /Type /XObject /Subtype /Image /ColorSpace /DeviceRGB /BitsPerComponent 8 /Filter /FlateDecode /Width 720 /Height 633 /Length 11644 >> stream x Hzgmw][[ERQpވ/ȗ]_5J)G_o /7z˪a zk10v 5R*trCoSLdžӪi:BqZbcI pBKcJ~lCo9-QJ)MXIpBՔ>BiJ)Z7ir5ˌm 8FYzc؆ױRl[7ദRm 8uƆcc+7T毵ۆXkΈ 8SZ}!zCopQjpQ8qQ`lCoQRJ1Bo .z˚xkwpƣrU e=vp1q6]b 8!z˱ _#t۱ _Ԛb:7`Z1ylCoi1VSnjhN)|F)977૟F776RV )zxF7`xk))%7`6 mc Vm kNmݐ}VRJYI17`'i7`n kl#509n^on%6춡7`6)Ts7ǣ/'z~u8 6ܜ6711-bc'7`JBhnzCo<$)ߍm nc1Lz}4<Q7i6`ϱc~w$촵Wm! 4}!7;m 7Or":7{QJ ؆51N7gyN1Z ^R7{mԚB(L16 nczjblCo v1zvSJ' Nc%6`بm ^czwx77{czCo >Y؆ Iz=WRb !)zCoRL諸/0Ko ۷< 70 ﶁ|cJ@opYx7qzKIlzȈm4׳nalLj `TW֜v2zX6>v0&z2zs) CtH9 .`y-1f%9Pqbz-:a%ױbr 5c1ڎ4McNl%=6l+ 3?II)N> < 2MSJ}) .isnc2@/ym#h zc,zݞSJn!cS*%jNc9/1M6z`֔ 1mlc%erJ9gm7c1 )6Zk1zColzpzHF:BI`h7m8@o ^na0 1dl7RjzCoxL@o <9$7vcL)}\ .NoD6oF4< J!"6z`/5uiBoCEo NdK1zCotHJ))Il7o6bJmtJ zCob\6nHo<9Qi%`z`r} ki־ ۉl9xz湖 7c\ pM4ŔjG_ kױ\Rz~ F+%hl3}7 +nulEo\Fk-`k/NHo\4M1XNIo\9ŒzJZ?i ޵6ag7dFpnz_<68=ЯRpY0 z7z4c~i~m Нn 7R[ !m h6<1j :7zsN9 .ZS`8qc!)tKoB,8n~ 3m$AZc-wzZk6pN}l#۰z`؆mmq7mcJ1R} z`Kʳ`Ao촵W-)m1̈FN+)L鐔ü't!4mM!gc7vm# }sHJkm( -xfDAo& <6W9< m<ޖͣ/76KG_tIolF 6@o `6j!L`Ao `CRVzCo;mLF1zCo{`Ao `'drz1Ƹ$W74ulXI7vXXI76R-7VRqZ7󐔔CR@o `ȥm7]6| zCo{alZIR) [zComc n7߾q6@o `6rJH7VRjM!: 64c7qG_܅fݷ<770̓ zG/ 4:$ZI!Tc7S諀;MZzCo !)7FV͈~c1'm^J)!wN'm 6ۀUc!)VRxzZl 8\O[Od 6<p9Szez=\J} g7+g7Xw07k9Xs'7 X8'\@)knXI@߱ck-@צi)U¹ _F^WR:F5hlOo]6)VWp~z4MKlR@o4s-6'z5m@_ЗW+mz7S9??O7c1ۀ ; z7. PJ>*7r)z.cx<̈BpfKf oo6wz80 )z.+<ۀK9>ގ @o ulmU 0M)Ecp)z8Vkd ^vecBǣ/[nZVNbjJ2սs1:,#z8!gӢ[)%Akmz<.Oz#z8CbYIFJ2QoEoGu^ZJ[\tOkZ)ƏoRU;br<[V1 ȱu-zoc\cGoEoG -ϋ؆G.eR{ /7xtz;z8gyy6mq?O -b}!t wn|~M˓ %7~}W~e𱅂xqb| ;k4}ɭ77/[I !cl!䋜SG_Xna^>F_?5WOXZǖ`%ea5w߃ ǖYFw$lmcr477}S[(?o춡7.@oŇW^R0 V^cymVRN|IotGozHJ1[qԲ,~+77O%0za'Ÿerqz1n)u6a~䋸~kl[Ǽϭ77_XIydl-+)Cnnz;zb% ֡w}x鍾 `JJYۘ&|ֱ=olR>_'|Fw"~\T>-V;7Do66ش1K_ ?mxy:z;z !8$-J6f?P!m a}ʥ!ZʁO|x8 ώcz_zi `l-c77)mi-Y좛ޟ5-+)|j6[I@mxey: nz;zncjbFbMotGo؆^R:ɭ77֡ :Pk177Zkሓ/ǭr /4֎B.|u-74'_Ĝmil#tEotGo <Vc8؆ހiDk1gp+4k6qp߶P8 'gVZotGoM,QK}ˇ0Vp$d 6m6F89Fzlcݘ%|[EotGo=6llWmq%z.ԒbEZ0tѥz;z.l[xx`8 177-֓/ʒG_ 1y:z;z.k=X)t6 1ZDlF_ހK1 Ney amcW4οǛ߇01ހד/ )| u-Z[B_cz_zd6L6r<>Fw\b緊ހquUЁt:]Ip WAsl'ހ XĆ^^ؘEotGo |}k-]N ]3$}t`=N'.ף7k G_WK]c*hZ~l0|!?1qzztjBk}J)WQFwtiSrH bqGހZS[(*)^oMotGo@wƱŘO [{~nze] \gnyZTotGo@GK>A챍Rꭢ77#ϵ4N5!|J꺒r /hFkVRx*ƕo]X6R]RYݎހޔ\m*z;zίIc˭2 8/o%% ᒻm pfϱ}!t Ƙ]n5ی[(c% Ok-0E{ֆۭTotGo9MqBov /'4'_ymng3k5R8*z[n47z7Ti26v.pdm#ZIanrU O-W7Пa]_KaVotGo,?qjqhs aI/FoA)moM;m~ 8\-%`lL*zGzgpx<6jM1ژEotJoc6x}"ۘB\n6Fz<ŐS?nN1\~ 8J)%ڋ 3%gހvXP˗`ϱ4qLoLo=I[~SJy:ZCotNo׿1fDƵ b`q荻ǣ *z쾅B^y=Ζ[%7`߱Rr~y˭RcG_H7Fwor6}+=yl㼾UbL1}k)@~VYWRt޸ n|Gm^)< q'z>glcrfԼUt6 q^x_lcq?z|%O[6fInz?D 63 6= O bP`Ӊl!؆޸)"b߽n$7޸-zx^mv4Wm [(eVcnqsz~O ֣)dXo7w6r!}rnz1x< :PjM1zoZO' .RLjdicrH@oomdclUb8$ݢ7kc6fYj#:OGo7WV[q^*ﵵ;ހ۰`z. 啔m{ |m7cހoQ;nm K XWR!ζ᯿<@otGopsxJN8 ~,E-\oy)Ÿw?Yߘ^g7%<-)&@opW^nqs&|Z[797/z;x~5-?K9]:cCG./@opilj)u>'|z|֩+󷆉q] .fF)˭c}]?9[nBopUR_D:hO,(/ٸ9%-ώTzl#ƶ<[5|mk[7fxǹ*3,OZJJqj O)ǔIop1-wG_4s4_=p.Cop%8|~xpv4ah6 ǧp7z8CC0߇ca0f% +)OEq Q7vg_Oc]{mwlUp{I)V6wKd> stream xz8819#ȴim ^+r,~I[.^__;w3MS矽£)0t aBۻ%0 UU].o"o[۶)ƽ[ÛPw;M4i o;>Ba1NӴwKxtH&)kE ycqu]£'BK|]> yck {18ʥGִmNiVpZZFYVu SJ]ۙ8BI{s7eFׅ'E]mӼ W!7XPnm)M\z傪Gސ7mcjMځ}ι{3)Ҫ u]l=Ʊ> stream xxeq>xwv&Ͷ4 `EOE=+b/wg9PSϳ,YݝM${!۲ndneQN6MJ4MKRNٵ%?5qvg,a1CSS³ϗ:ch`¡F+g6@ozz /@oguBzr{GE߃ߤ+{RdBWYiqvc~FE {}A/$c-ub)6yг{C+z#ŗw~$ɍv'H=r 1mge5^Mbhke|棎,7OjY6W.]l \\PhH zLixoklF&Ⱥ4!]Vhm1Ib@|W49`K&}xKz/ܖ{eS?(RANI;;ne÷>MRVH~,5e#Ik/4)juE*vLYbRA^i׿ER\(#3e_O蘭s󴷷)=FƧۖjJ' |/9ilԙlEg*8L5Sl}KfogL!%ny/XX8\9S٭ )]/\ z@m0(% 8%)>o5)(~SrɥK/UΰL3H68 QyO^uu9hԘMMNjtŧ_`Ӄ$xmE K_w N?Rׇ~osf?^~Ν--- o- wԎkopn /$'K橕=, /}j׮^Y꩚UO֮YE"HJ.|g~zuٖqQ[.gzvښ^Dl1IlORqݵSI1(WEy c+\۶?v-`K,EMo^yelx#˛ˮNTMì3 .T'T|y-9 %l>޺JQ\ zp1ueݘ;.B$^='͛:zJi ܺ# %u0Ę%W}hJT֜3j|w7RޔFS_mObL>al!Cڢ^qU:oiJٹ ^3e~}qQE^ԙg:fdisW 7SHIF%ɆO>,aiqwQ_xֹIN݇1"Q:ƈv6[c4$%06)/լZ;fR zp1r\˿ku7Z㫯6Z+-YpuRub{9%L>+c#%Ř.|K7Gmϟ>KJHEz\_a E[&F7uzg}=k)I3zmR5i\dOj q(+1aLDHq9g_th7>aW씲sGOT&ktXUU+lZ> [ߓĿܛ3r5"AeL=WjM)a-XK\۷r۶[o.nH`2hWi$AN29a?ϻP}TsFOl~sԱަ:HMi3|}zmQS /ޱ]ͪYOFC;2>+٢4nzO?mnOM:vLE/+Yǎ,[zCˆrGMu\z⺿=+B򁇫_!#!k==_h"{Ο_ȣuktX8Aom'^umcmщRlhC`P)rQN2yN;o>[֤쾩 _웟5,䲅-%eƍKo,]tF'͓ˮnSZSW7N-:m7߾k<Ցu'%PGzkksdž.Eqf}E'Hu6UlJ\]re?__Bo)7} {)aʟ9\~%*M}quoczoDh fvoRRZI͟=[@iskF=mJsjVjx3Ͳ'DDċɛ6xm_jSŠ.\Йdҫn'*oE2ts͚URbJ像V>)|&v,:QK՟fF&Pi7ԛ;W_=ibȐL1e[.bQ!%sF{t\vCxhy٘9ᵗfuQ/u/]-&i?sϭ[l%{k%csE]ܙo:/l QtvSp4?厙P{ ~~?䌚(-04Wj׬z 8QQ7Y REKۿ2朜D_}d}Z֯N6O% !g7_oٸ#$^њabtHYSJ7zeBk|c9+X#dd9ql9]m G߰+ǍVW\~~xi)礱E]G% /9+r=%z5ƦT&I=r|ɂꊻ>fdE/7 F_m.kd_Ov8MyMx]ٲ]兕>;}M19M4Fֱ]]3BSR-":rv̝+7训[:>\<Ag3+KV<&"$uKoӫV,?9Pr垆g|y=#bk!j׬3]_/'i3=O<ϙSuծeNi䓭FMl7 "7dCz٢YgN%KV1;x">%未iqӿ+eHlRk۸Rik_m}ze稷\Ѫ {2I[O>Q4|YGoQv5bָuѢy_0o,E3@o0 },FqyJ4Q3r YWjJ.%}wLzIIS PăxAT`k[ْUo /S;n1_nACVVoW $M+!߆V}ӥCt>mJޠ7 XoH~}u1WѫwU[PܦWݒ]{թTwCQM=_-rkI]|Ȯ'FBt zo s,{? 'ޠ7 0`r0 zB7`<>N8l Fj$FFyIVq<ЙhAo7 tJ)ٸdA<٬~-E0!Guqҫ}fuKU?Xi։R/6݋OE%Z&Ycm1I#$Ao }`aiSbLU)̩Q] K_*I5>On :F?i~?3\1E\ t'Cq fo2֭uw݈w{~uW~tbYk%hd:@CJ+:Sg]F݋s)}9bĎ ^I\&dLwR9JA?Ao07}7|Ү&OC52m˛,DJYZ<K//>%p8j cG-]mU\0g8f[dOYxفHo $h7?7_8ehz 7\^Ynݳ[rN:xo>yi9Sbm`]qzϚW5oS̶$Y3˯[V؊ \AMQ5}oT/_Yʖ _~!p1s!bURLKojy?iٛ]I3$GJu ްE$l]rU)Y[tMw*JmY0kҽ>XCZMg4~۲K.ƛ[?X6#%YwOȔښ_!ߙ;,;= ]=qC7jDzxS8"['["ݕۃۯ{fp)I;jܖ+u-ohٰAɘ)IU}q>ntK/1':2!JMNuQY1Z&Dl6o[:Y#cdAů\39!S?}4Ϝ;6\|h3 nDIͰ1+ pVxjΨ 'f7>{R^N4b 9Q-Mݔųa%Iq[xְoyfb/P@Tvu1v%;[#5.58uSDrN3Q/|Ih{iOq/.P~ub7 9G/7e{mժ'+>t)6wxmѼ_w櫗Te`'sK.LJ6ew.gjWjuRONX,Esks`o2!O_E3sGN{SRN= zBΡjǟ]L՟θY#DwkskEoT}YsLE~46Y֚sMy=4hywϛ<=k:b)=G޸zô!e4Mu_آ}3,cqGp;2!﫵x 4TD9$4)1`NTv_ thxy)I'Kj_fʔt3g^a-{Ð9OO,]r-Jc`Ϝ'v̟uzS,QHKdTq'l4nI zcP@HHqZ9ɠ.O#3uWbXBv4w$=uJRUd~ kXlgoc^ꩩ9{AޞuHzԿ?k%}e~O- g7?~oLn~7mw2)rqι։Ei1*{ws -<9gI\!ƃޠ7`FݚնF̳M{F>/sZ'(v-2z#,`͛UsY&DK)!k:F]4l]ƃޠ7`;v\ܭ74훿 ,͡{?7"51,d{Yǎj|1KX4=@oZ77/Ntw#]{#A7ck6u S"]wݵf_˝_e֨]B1e~=bx[aߠ7/, ٔ!% &ENIL];DkWR{Ð!2[tRLWw[Lb7Z+puBݜi;Z{l nfʜ1S)P-)F=OZŃ;GmJzcsJxٍ׋r'Fo7Ao`^7[FYxe\d=X|H~B=AQו9#Z&q:.R y|{zdւ/GP>ocz/5NII5)QR~#gz[5ּkKUqm׽[)%k7ɵֺ*K[?؇7۾QV綘;rUmB}JowK_jMܩlv[>٠>;_jU[F]ԉ;~qիVn30m n9qzO>[TRm1{S,x`gPgM>2)n6Yc=I<ҕThuOz7861)4[TB]?19)]jw ꞛ5-Fd7# o~y#6mC7=8:>yE{{Kvӫi!rwsSl>}\V܇t$ޞ.kwцݠ7 ~ېGdo0!zAo04 zzAo  z` zc7?E]Mːn7RBdP i$0 )V[0O?]֚Ƞ7  lgΐvyqxKk+LzczA Se|T%[aރޠ7p)ɛ2σo dzczrQJL۳}o77 8Ӭt/G 7 8l3Dl,Xmk8q zL[&otOݎoOlp=H-1EN7SF&Ao@?{eBduDj,᱕>׷)!b?V7!EA-a:#+Coie{1l{ޠ7ϋz :z@7Ao @o:z@7Ao @o:z@7Ao @o:z@7Ao @o:z@7Ao @o:z@7Ao @o:z@hxܞz`Nvt'7|>x}>q\~>w{.0@WR\NQg`n~q%t|>X`8Nz`._)`V:v#Jo~&*bciGG` Gr:x z˴]7@?i8Dn{6 phmt9]I7^w_Oo#t:c7.^oBot:hrz 56}Eos\괍 zWl=n˵_7FWWy=|rS .S$A~s@`?y6|5m?6k#0mum`#u9z }i/`ֆP`+)Bo\I9vyzЕq: ryJ ݼcggw!-Eot8ԛ X p ;ẺNgAoǀ8-w8:w zrqN<c mẻ:mH~r|vjGn 8mym\.n+)Gpz#Y/bb c~&)Nu8KopD 1(6 ^pxiN_m].i[Wt zav:Xz\0m`xnYS'p!1m`z.Ao0̨6.3. v&)Û57I7~8;7m`xty{G bΞ!p6 B]p8 z;N{HO۠7iZ`r::}>ϐ\݋ Ν;<;Ð '4m" i!پs`lGggwLjojG endstream endobj 11 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Filter /DCTDecode /ColorSpace /DeviceRGB /Width 370 /Height 84 /Length 6638 >> stream JFIF``C     C   Tr" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?S((((>'H~.zĘ\G ?r5''je%֕)שT'dolYle :n#ݴ1\J_>?վ'|\-fc-ݬ$&~Hc6Tq&ĬhUUΏS7enJ7i7^EWAQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@~ej_XKMn»W0JsZlQ#._sf?Dy|*n+8~/W7<;v>nH:FNT_}?Vo WSM37IxSOv4GQ|pu/!54m lwlc~zv?_#S_3Ο5 '~~$~yo'Qܛd ʯ\{%|K1]]Cck5ĩ(dY O`~e~&#G}5;NGz4=[g&ׇ֛ 17S[?߂xWU+l?wg/vO}w?j"[u|@?ᕵڥ֜.Negnq #gB|c6RWw> y[?J?[bۖGSIKnLnk:8I`k+W .Qn5͵#P9$פ|1r}54mKQ ?y~֟Zo3 vK}V#woioa4_2gkvJ[G,AZmwQBWR25-4+~۟Vɷ-fW*3 2AʆQE (hڳ ,jцtdEwV9;y'4WKwo!6&wd+EPEPEy "! OdCُzOٯoVƚ,$V-GʮG%zv}}ER(((((((27kM27i1w-&:zLt#>RTnV u!OXpG e'о7|&麗zy$r=[}0x&3w^/Xga+ya'sG 4}_ڰ_NhZؗL񛆼7`m|a_T%QEIA@?J4 K^T|~σM*DdA/F辭 y}ms+Ś~pMǧsa$`G瞆>U-GzĻ+$14U{O$כ{rG'8? ;qq-ij+<^I$bNI$$ܿe_2|eu(|+:pV}:/`k~1Ců k1qq*v+)FgTqSPo/^ZE;?lx1hO/fJ9vF5~c~П_>%ͩTx3?y[?J>8I`kj:ohR56I<{WG)?ok~՗Ow@ܒV8}Qԁd%9J![dbkPA8=k 7 Zci>#nsָ;/lnfrV3@º >-~MTKaFAevݒ'Cm!~߲#:#R$ !3Щ xJu kF:]ص".d+`wcY O&a|j֙"Z=ўkqeߥ=m~0[5RGXH31I>Z>,^h6Υڵ;R?YI^w^9FK+$WMEA \zпoTM&Emߐ5߲arĞ%uЭ6Z[ƹXu2F9_Wm<k OZ<4w(,q,9țG`>NJhjM.-ruЎ+r S?>|Reo-vUȲHf݅'я?l8O+_ҳ߇? D:ܓjr4ih$|1,FpqSt7A}km}reV>7?e=+Gž2{ h4h"Gacp GLS?joCGssHt2V!VDc}QVa4 aA_ t.Hq * 1'=s_n_x2rv ][F\Fmwg k\[ i)^1xL)~~mw@YkۛzFYPPr=3_~Ӟ7OfVD1/-lvINFU$}[̓ξ)'Y#teu9 D{# c^7?zs>nZfź3_(U=/?׍Bف9EV`QEQEQEQEQEQEQExF][IxF][&4~Oi &H|3mGEx~7Mekbx$j ߊOn+ʹwDOE*A_q6d~#U ne8TE-#'=ՅsWs]l-˫.ړ%ͩT?G## ƻ[3xs㖡|f`&ہ7\ B# ƾ_d׬KM]H>]|ѱ>0}8 =~ k HhG.^/ᆅk!ic[Lc;XGl10?|$^g6dJ8ꮇS^;ZsM}$}$ n:jρ?~ F^Xkݨ-#=@Gs_ۯ"?[ϊ/y;i&y{X06q]%ȩ|a#akWK+XG&ncb8 4x?v?#?jy[vBnO.v3~U CԑC)'hZ=Lˊ7N?D%wKVE5Y-4{ ɧ˃w1;c r W}@ka Ƕed[/-uvW]~?jr~nMWI4?Q s[\F9e<\(!w5JQW*&jSq^M *iY$ajPr*FkԿf?ZƣuWR75,K3bI$צQTFu*NIq;Oww7^vᛛ.lҨ9 d5QE33 |md-5W^Bm?QO?m>>^E02 ҆vfgQz>;> +H(b7Vq TǵtR۩o2#yN19$l@p-x|{q:~slz\7Y÷uc5gG}yk(UV5 *P0[]Ojr:4}NPWvQ#`2d? 3|24+]Qw(KkY-dpqkH~hw{i8\#V4H~tSB(UT : |a?-z71u@y6|1oM´Ё!a]GS[>/V{dkDƟ\~xNZt[ Wp̘?*x;š/*T7( u4PVچ!Or}xh ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (? endstream endobj 14 0 obj << /Filter /FlateDecode /Length 111430 /Length1 243324 >> stream x |[ŵ8J!&@[C,g$Y~{;w9뜙vFi1 l!֚ liGWX5}oN|+efͮr 1B>s7]-BxKߒ.oip,lu@V,۰|2f_? $Z޿i"+@k\p]BKޫ?yOmfF! %<'/B0±/$YIEAN9 )-N{)K3[ yw9 Z㔂bx4s Q,bS}ͲZ l!/ ,ܣ&"W&t?N{NDڙ~wBfbjKyP(\A+'fst$,ݴWTz%w5nU1vw734~<*i b 1C<oR}ni_D;Vt[A oCDxֺA&mkϩXGkឨ{9.rdLv 3=Xg\i%;`S%06nU5wBl66E9᰻W%t1m <=deo~Bf*7qZV P?kLn`bF2ܘ? xjbl.NF'Yl0lX*pu4G}*&~i1a=GW9NJ"Y6d]qqڠUj;(ޒ^QOlKhɉo?\mOuD1k_-zSƏC&MI`g}+(7(^g܍̸0Qa: ;{Ю@T7Ķ.' jJ_޴'&4DЃ(!<ckOM^ڽt`ByN"oϠ#&v$F!WcKxYOI)|n-d(#$?bsf)s)bs&JXD& \%ʒ~==sW; ʘFD?;a󤛎!il Ic2GS?8\DP.ڮ}+mSRs7QLdE=W_+?P6JkJUd9w6.U?8ȈCTa4UkTϩTTy0*|*|*L>HN Sc›oR7R_ JSC-ͩ`+Uؙ*H RT;UJST%UhNS_MSO JJ_qK>O8Op}8679<~ïr9sqsaC{8|wsx7rx9|`ٺ8|-snp5+0U(  `=[s_":_[xi!^kz BA5 ^H c(օкZBBh] jGp&@`NccǨc;=$2O3Č}N3V{sU*FCuCkcVLXĊ*3#PwQ& 0` 8]v1!t5zט / ֬z޼zݖK6_ե/_hJ@KWhKW lL3m_Uc] `SAP({CL I?S?0fQ³߇H6uA=4#4ju-M]O]x_G]s6_E/srjA:Dm8h~F]IuPϐڈL!JzJvJਛ 9y~ dW'+9+e01 '&M|YfjnS2_O9(pV5F;z"`aI͂|5jVJHLr(@2K~ Z O.B=-|% SKz:fRak5 P,q] ׄ J\A=F_r/! u%6h/ \CUzʛQ!'/$<#!SAͤ-UM)WWANz@N^/Mɼ([ya92%sy5Fi@2R&R2ȅsH#H@8cp0,S&iS:v 0exF2^|.m[mnd>F(Ǔ1)  f!^8(A?Y?˙z>e~vG'I[?o`T+Fopd-7e~`6:]N]SuҀN}:ګCoQ(ts\8G_GFc<4%gE-` : spv8+l gacXVaQ(1u j骎i0䳪cAwm-1Q1jsW5DA7{Xi q-(ٚjHVKj:bf{biKS*ǥ9κX^]SWNr oh|j"ω\So s%tl|NËW\}N=s!RbXdw~""jv2-Wસ}~Lj7%fs&"dDt?j (`3iS|)INqco _ `(C 0 `'zZZ|^|@cWF~"z:z*:,I?Eߎ!ft8z4Z+ї/F_<ѽч7GDoFoDGonn^68m6Fֻ/SϿ5f#%r' PN?({㝓exHFzt㧩cH9(X-$tTM6X2o97Ễ_WO \Yt8Yc4=>3=mGy F p#ڋN>!?72*GI|o\MfށG&[>FUhڇbl4?Q#Zc.mD~Z{Yԉ?f"3T VGS7[ft z KH{f}caOt91+f/3):N4>/W_C[~;9(% xl nOF9@;x](y֡z"z$O!STrݾZ~E^p@ƆrX9 *w^pQa%URI:YrJ`/*.2(.Ngًʦ"@yYQUieD}kT+S'PߊώCޑW2y!{K6;-uVVU?wf.bg0pC?>*n8u#YȄ[u>FCP6mjjM% Z(>RIgȘ%юl.QXj53\B%UH Rq8)C/: ĚbPR%N[326JZ*~>s`F͕fη?d*kM"_s*~¬6b_lrkU0d>~(N¢|'JX1)Q ckEEb7HJbIvɭ$<)-|) `#{_Cg4ibҐ]hpe,|-uJVcRjZa8yT/(!zݜ%nEF-ZkTݻ1FHW$w6&.P$v|{YTM$+`@'H>Ҝ@qqC{nǖ3q" }[V/"L.Os/_+ծi._]eU+(#nm(KjPzYxޏF-d˥sfyJ RfiLfWұ'៌) 4`#Qdx5 # I. t$H2I{%742+e⚍g:LTm_?<ɜUd"}EjQ7_|e{scJ4̆.gkR1qVMjeBMu6F534N6STVNo0{@@qiH2t#-"KFҌލ@^@A&75cY_Cl(8gnglxm{n7Z2 --.|;rhm$t9[zLTUZK{ Y UBVX| |SbM f7$9S8L%M.7_~ͳ`ѕ7Tu.ZXM/_yvv/:<{͍MK~   BٹնNK, iᝇ8[LN"%ց*Jr\ɳJC4 (Lt㝬)#wz.45Ceggت[J nD9~&|;O `a0FZt8 8_61g9WG+bs,W%N X^BicaNg~w=~iQfO ZjjOZst}WuyَƖxyY_1_S(j o}rWcٝ\$suJNe慷wC.Ms "sU_v}YugG 3eUl&ܥraAJWYg-;-E!,0>#G 9DSM\8Dz=8w""u 3k{%sr Wy2WAfِv\w|ǩsFË5mug|܈] ZS{\& T:.e`ɳ 4W *jBs<cb՚t)l~"h@i(qrb' /WGލ# !qJ0x2 c+^f^]`gx "XќO"鑏1`_-f_Yr0Ĵȉ#1T'YsS$ &,US~GNlꝪuͼIH·1PЛ=ud5|̡P`)*JaZoŋ .HJ.8[f 0W.GIxtXO8 _pm]w؛Pmi4vN隶Q]aJbhd ( 9QĜe+=Eΰ~&LJ3b Gg$DV"R_l.^oIϛ4։@F8$J8> &לDa8+%cxZ͉UI BJW6?{6]V\yNG[}55iv/sTQ#NU;,QCniE!^+"q_Ɇ2)J(%Eh5|XϰM|9j U٫VgLK8 r'JD {{HludC{.GٞmukD?{n7Z{+^v2ӀX_w(| dZ 25lT tk$v>!@HfDpH<))I؞ *S* ёKo,{(X_rV9, cCwR!,uBP9Vlt 1{l7bHsrs(lg{E">_t*{u:VLQKblʋ:U5ADdABR%$".ipR7>ΕzW0/T}1tBc~Y!}$][˲f?_Ԛ@rHҹr.ZKJe2 `i:ZwF**u:RUOeeyM_ &&OR O->5U mM%)8~.ػWz͍=U"|U^\Ya$Qy[}k-յ0M0ٕ 3W샨-ph]3SytFfƾL#P:VSZt%9L aA71SqyRST (j$-P1yH@B2UyIgs[Ipᛋs eN s=Up*eURvx|ht,p3Hso4O2f0 z&Jֵoob]$Т ۼ)ݥ`} Ri:6 &#CɅvGBlB_d,#%!^ϏAb2JdZL(#hv R/TÊHKk K!S%gYc%"ፍ[/͕Wͻnmk-KNȥ?:tZџ?#Y/U]/*CkR!' #"ZKXxpV0 sGl5+R5 $>ɒsR"ɥqn a)"acl U-M#rTuMI^$J@H%<2 &;KS>i' WVvjE^65`Â[Ҁ׷J\s-HIyޜ Y>SdB9(t.?)eUJ)mC5cx3LC#) P*Ta \Qʝm@p:ꃄpsh rIEbqYK%-þu\ ?=g+^P^ |[ڳu\ F?4br1{A AgzUN)D#%j4;jҀ6eTnU)'λJu}uHs n¹QJaꉟZXQR97[mW8p,^%/\OT݌#`D+1jy 0eVE: QO:c2t_lTxԪP`Qް#;3'uryiIAL98M=(H$/km;oɖmsz:A!'Xeyh_ekn)~_.뮒g9tD3>yPD7yuQkQa4z`Fm40Y0D,I$+& f)2aѦ<۬IΩl0%aS pzA&+;wYPE- ,(TUt )>TSyௗ.\9/1ʧ{Q9jA0pC$t$ӊ6(™HTR"%9U(7-7g4*?b4_71IDMM&&O>iDzY'=F )`^ޛ: ED^@ F{nsxFN64w4:{ Vx[/qS\'|w2i<ʑIW`{aoH=CfD //M=$5*< kV|g=3 w+Pe[,na*jYEK**VH'B~AKd <-]^X^vG"!8+;R4ql\(;0+\EW r|*h13{RRgʳz5By4ϛ:LN) {tJf'Lg=Nq;~̑&Zs2Lފ4ϙ&姗7k׊EjʆRuS@+"k]/? k@Vư,aĪ :n0)Qd)H>5_i$u99AgO$㧁rON]i"0nFGNaq&[rYMN. !=pUڑ_e%);li*Myb[|4bS+H Ѽ'8&%3*]9 Y7&#VHX/G}3r՚/TSb4LH*qD`jq3#e1zs sitG@SgYT^H 2i]'A+a0+#ȓZhID! Xa)K50Y6#xb'[a|}immu~о[׬?Қw[^]3ވa`"Z@OɎdcv ~"Vu ByC tQ+Wq͕8O\{B `A=Kt*ykDmJ$&F ~$ADNq4=ݧ_7^!s&z KmRd&b(x|-?FklɊV 24h *y>"y"nh/@94_  'S1|.ve27 @7GwF]cff5=l5T0= cfg3dry(k{g=k1%%s!ŀIk328;`2J~+خ'$8T u=jնYza]ӏŏad}}W|+$9ԕy,W\iTEyzU|kfu'.y?瑀#>(] NcrƆ5| B3!W{*d^pĆ.aeGD1?bR", <l"1S1H*Ӵo櫶*j >ÁLjPC_ C >9^zk~wq2㎃d8r53Ӫorl9uwc0?o~ k:5O2ZX4*H,b(aOsal}N`MXP o؅G٨X _X22rKPK+^$pD淒O؀9 kK 4,Χv'gh)Նbu4? ygkj{Q0y7WddxBkGWy2Q9kXVaug▯FG56[|;@y$[#gY)+mjex?8ƿ: #NFNSqD4J)DF:D2GQ46 Vk@}Shǫle<2deQc/ﮯ6bЗi'i^RTuˍ+t)Y.]Ƿ*Y -h!t6O}G\RQ>;{\o&.e{h暴;XmS S¢?ZXt4)Ljg}{YK{|rLe^$=`oŪΦHn=LH" c@&3m0JD~:%Pz`$C`c@} L~eb"x$S&;lνiIq5/sk+[|5҆E|\楛 ksUTͶ_+,Y t,uj/uIKvgqT&A?hp\^_e="f$0af/1EB)Q nNS@*]]Qvdu5f56kϽ--Kϭ'r 7.jgϪC.;/o!slq%jHr U\pEЌgWB~$l#%J!wɳ,~Α\+IV /5d2d__sa#sf}w 9^@P}xoʰn׹5?_f }U0.\|]c:vU:UYjr?dUVIy;@,~3G,VI|Bޢmo(ছpg\O t#v<#W {_eZɘ,loB G FF;·&LKqS~Q7hyX4fjku~Zv$d7Hvj8iiՍI4E2<bz7A Sՠx4.\7Y3sFA_o{W1@MS7Q3Cx @p߅,puyjܻѣsG?Á0#a\#鉯+kd) _NOQ W|eeM wt?{Q}5jyBaOڼj,+!=G+GҬ#&+u[ $NXaH+Ĕ?̣\blBOOC~Bu3!fy>KR_=83Sf/O(5{s y49;Ɨpsr~h9E F2QHLX`z%"̮-c.>a%-5o%u?-.6.Lm/ݺ[]62S6xv㶗vR+^{%.|+!fU>>$J 9NB<,<$HRS့7svuz ML1辎Y=%[%tKd+nbCI1Ağ:_s2_RHS,ӯ+`_ TCf>>4$ƖfˊHr1d֞8{$ʲ'j |&E srKJVܵ3.Yn*lѹUuwukfQy.McM'?`kJfllX4[,1:y뫘QشNgoi{gUX3u2ƣi]-dYav5gGiOZQg[aG`І#FB5X`9=M2W]l&&oueճ9z 鹌ʨ.pUUڇ;Pãkv"#35(sP1S*5%KLTt)X 5%65614(j'&bV~{ {{k{{]=9G v8n@~}6CGmp/KߋPIp 7F\~M!((m򶶥݂ q״%Of4M,.UJB®?|ְ$e_'E$貶5wxRRx s|W/y)>S#Pƞ{  :8p0Si[+xFFKR(imi{J+I1IWKG]ٷm}G CƌKײַ{Ԙ@:<?M7׷{a>ȁ/F؇{1"$׀D?7_ϒ|q+Km1ˁAhrۥд25]%pqx5Vκ=:?͹&~[nY1u!Ij ޗ1ByX3WE 4<􎶊 ~QD7y><8ʻgI/?i[_LMMYw{Θ[Ji KddY}OgjsG&{Mi_ęAC^bNGHk=nBH]_iN󁨅 nYmYɳ6;ӷ9zfGLM.yH)R~\IbA'˙l8=xNt(jtq` a;;~mp_XK.!ylW7;gOpϬھ2oժI_\sr&DLH};&1ެ3g ߜk>u&Knoml}Lz5GGlV .f1ޯx~$Ԣ_]}-/Ɲ!+ڛnCgL'x11UbSX- ̺ +1hJ/oAz k,>4yt{O KG[5U!j,KMo7ԝ/Nfn?{AJI]%\Ô>Ô>o0w}&~8`@LTdz~~,"yοm>Ezr,wGy32* }6_]o3l#}qe3VD0vkfڎ.5gm/;j촅ItZ_%E"7 g#}MF ~caYCQpѫׇ Y[U69q#|_ 8o=}񒟟` CbcHbքު+)P I+,+`1QZ}iքSYE@ì.}ee?7NqxA~jrQ<~!>cV9|Զ#']}rk 1uUkUkCa/ceѓfLm1q Iivඔϵk雴શx cM? k>;0Bp߈%X;1=cYXu%×O>ޖK_?m46~Ĺ";?shǯ_#!tLy\zjD9>UԔⶤG<BYDQ^t_jҀnmbR'ŵeΛ+&,}&&GƀaBC"$ɷ@ &STsD{yASVgo>v*ˇ-qj7d2lQ[nސ;'x3 4vh\Jά>sNjdqI7KM)%0Ot=_\E,9J.E w2ϛmǞi;sŔ R C<ݑqGF8Og$%5a/\qtn~qIIgL8 rH4ߟEe|i;;eW]*;:u多?˥IZOOrۡ? ~>SRunO *?^L 9g}dUMy_t~% +cPz{k$(53ꌷ*4'CJLseRQWJ/OOZvXv=)eҽ]+uԕRWJ]+uԕT?zLL'C=*U۫W{OU\)O3+?KSqZzoZc$ғ{_TZI|TKm]|4+uԕRWJ]+uԕRWJ]+uԕRWJ]+uԕRWzRa!e' ?q! wȥlu{zuS=K-W'װrF:%D1gNbYY~(Qůnc{ lRKsZG=z~Cߩ{6̙]Sz+?.<\7^x?Dzej擩D|mGi^u%m|X(DhAbz(m?8 ~V׋A!~{}:,iO0*䬶/ m_'}_:~Bu>@L@Ɛ_ /y.I=vNdS:TԭUjiQjfSG(S\/֨)NhCNXT\EO< C!g۟ɾқоre7k?J#hf]҆ULU~#+|VvGvuxq4uĕ'NSXf(wxy}s0UVҼ|}=6V3Wdo2ϵޣ^X^4m,}%+x4ʥUW(v4١sj'"ec?xQw# ֙j_^ݝ?yjSt&޺C8%$]QCI!Ѣ]TV~/& NE:$(D=6I*kV*U|+V /X%Vf`P<~Z`z:CY_},jo,Y }oa-W|龢;1dAAġyjJVS|щC"[-!R렇/|ovp /K?֖Rpwfl]+wX쏵BBа33;IeֲYEVfjRtC)) I a']훰9asҘD%YFXF] ) N[ZŖGew4zji0ZSZcMn6M5b1Hz ?"v6b@qZzZ3IV9K1d` L+ϤRSS 8dZg&2Qv 7|xfpoM ?>1ϖg[{gXfXHC#Dhׇ-}hbdeb(уQ׭[JAA5A"48k%)0ӊړS,N8ɰI!,4a=ܑV EAy7l;thPogC>AS[^釢P_)o)+K=VϴgIAyν WUoʣO\~X|ҽ;)Oݚk{m}\P7m+wyJ$C~Rh@}}V[,#O-_wラܶT+*1Xܧ;%| aE})`XU{޼/)kmu9։ V &3sDwޜYV:Z@+}_""}?ھea\K(R[Vu[n#;xRSR7unխZGhU+u6BRu;^NX=Y}POzsL* tI#:+[W +K{=7l^l)xW-⼤zICRXʖK[r)U]"_,(~ eOtK"H@`\8aK#t㓝:/k\?$v./s:oY޹Ŀsع|_;\~`Y\啽:Ok?KEuJ4+yCw .E Y%*ŐcCcK[CuiZKH].NUZΡ1imy%f{=x|%wkM1!&Yُ1/`66[-C,,غԒRL{S;%s_ORk(-P/)ӎ^]L-/צ!,YP1r /MJZR֮8mQӎ_MroOZ7Ԕ6thGCG?4btZmlsV:InϯMjg5qTbuf=>نcGlü}4F(7mxKovܼҦ%-[,*:cߤ//KfϴgR9sVsŧc2s2[gXf+ec'/9\yo佛Y~s3Ϲ `mFq6/ϵf[\w7wNVJ6|Pvڍ6VmtwE EEIyExmB{{_Oot{>+֓LEjɦl9~ɛn؜hͻ6?VҀ;p.s#ޒ>jN dsw"Jz-Z2$dyڒ-%;JI-!TtzVURZEE1ޥ%wE+Ջ/X\wy9Sj~ &ҥ)}:dQU;Zuֹ[ v4cmN!+:]S鑢CL^)oWZD[L̻sv {$M?RɣJ=S /o[~6w%K:GїtsE|*+ʯjʯJQE=<Ɏ֝;g7ޏ{۲k[M>BG?&ZXhߙًZ)]Z%潬;]zGyQ[o~;SBXrrV"J99AQӚny.%h񆤜kODw^ID'rݚn^\}L2]%lTAjQ,E =%B%[%mRIVVbPt-ZD"mN؛E|-RRnWaմݵN9wwzۺv_w{:frp?B\?`W2E?p4#zwb{}h ~kTpï>QoV6-T"jA}5naC&g%\!}&Kng.UgDspXLNJjYy(%|v$35R~$ξCn?kQ=/DQCy>TгzzVOO|grմܢqgk[KZvNi&H+Ѫ/O&ZǟqJ~ɑuԬftPYAiٰVd_[B=46{=O]ܥ^bzB]~.ܡ^bT8=1^\s\SU\UNmhVʓQg20\+,":1X z7"X 7i'V@&fV~6ȅ< .(a Bn܇GO~G ~@fQOl [Fc_Jg*r 'VY n6 KW |+|<+7MOixYx"^pBhrMdA !PQd\"H\#tjob7.rv쁽!8B< /P~_58sG[~- Y΁,c | C\o(!":hƐ k58M7K|.Z8N.3|?N0MFlmFlm0FQ>V.3N!/$_z I.7fxr6ngrNQ$+?&!n"&ӘgB>*goB d ùa#GhWX l0&!4 Hp-$, s!u K! A:d Y@N+ylX9 yp \Pa Blnpv6n7V>A 0`BR] "J"n `;;`'Kn  `?Ϣ*gQYT,rU9EUBUBU8|>f|-%W(O$a["-+!rU\~![0(L= sy*T>`;;`'}>OP."Tc#`O̅ȅB`#ãPQ8& ނ9ww]xj1  Kt` Zmbqx5knXky@dXqPjqU1Roq6P lr1 s \ZӬiqxVleU֨t@YSc:5ScZʩVNuΰz: +VVDVf+QJG_e[˚5o-Z[-ѭunm^A#{kQ ;F 'rֹs# xUB? ca8Vr+sdmp5$+LʒZ& (_ x11gr,rޡ D?C6*`}m8Xg3 Ev93~f(|ˀ?2Opfa?:: 77Gu* QЀ;kuË D>ß{^_5|^Uìk5sM!2ނEb]n "ccl`~+#}6g#}6W#}5V‹K / ˂ ,<ݖB,łBY3挅b,=j(-8*G,DШ;jU5+(VQ 8}7w(ux׍(VQiGY"/na.E RIŢXN@l =RrzVUct́1:fCb7u2Z@h-seK?0<B}{US gsϒ?G<Ex/ßi^_kX:pj[os ܷ>1ho8'8ĽNĕЌM_`ZW5o[?O3xtᥳKPhRA$sHUCp#(Tc8<OB%(oM\3t|&HxCQ 'Eޠ:_#^"^/ß^W/Wx l8,"j m&T lQ8E0N1!UPqc¿qeċh4l3b8"F86CA|XJ| 0QD&O!q38C"&q0K f s87q]*\} [7Qn4]&'_l a9%8WlWAҏ>˥ //gWU +b 9Ab -%-%-%jyg9?2$C␃d#وA6bd#وA⏍c#؈?6⏍c#?.⏃ ؈?6⏍I#-%-%وA6bd#وA6bP1TF *sn@C␃88"٢8PqdZ*vAq\AqFA6bd!D+7_Lk|5mD}QFԧȌjdF52SF޾+x>[c,eCGxwr.vpGFTKRCB7`3DROF(Ao{Y5V*XTcjRUJ5V*i j Ip-̂0<2e\VBe[VB![z 6F0-&N౧4FQfTjFQfTjFQfTꈯ#~? `armd8tW7ENO%n83 o5|~`\H~L?7J#Woa 1P'T 1VF+jc47+%a}4cyOxpnװ?fL`|1##ccLx=0>p#,` K! ?c:0F;, Y@>842[a=ƳlP&X ) %P,harmo{(A] ?~{Ea٩{YnB't"V7OJ_aBI̬N~WX_!׊h{@_1@`vfH^`2w85 ig /xdjfl93F w53Z βfY YV=t蒮7uh.N)ߡl1KNeC ~k=_د'?' P(?a+lp쀝P{_:]R̮\#WDJH."PzIJשy\c |5Cn&k=dMd@=`X[CQ;xɗ/A!<_rj_sh_t a0Ț̾rf_9Ʊg(_J#q'sTvc<(˹&!7$ڤ}&_㜿\a Mr)`n g\Jn N80V#c:&yLbS9Sd%1]!/5ESޛ2+G{Po SoF894\mAQcJR~qq|ewdʧPOՔ'Tڙ3̠N"̔+MIԹ:ɜE\7㹜O!OuOcL7M FXH{8z7Qo \<;So2+) \(Szzzz5o[0M?O3_ dY73f?`=f@ѼZ0ks!dVyyk:8:Ep;u6q\LԹ:%6s) wry`&6o{wPk^wQ[N6'O2||мkrAc~!#s#(?F\<|>1{,Bf1G,`" rF(R)TE4~D4rJFD*QѨhTE4"UFUD*QѨhTp&pՀ}>DRO)ѧSO'+WU((_;P*T U@(z]zWUw]zWUw]zWUw]zޥ(p(p \(p \We(p \ףU(p) \WU(pif鋲 Vx mBm-EmQzԶGP37j5Ԭ 5+Fijv5BͪP*Ԭ5kDQj5Ԭ5sfP*Ԭ5sfnM^CPbljVQ37j 5+C͊Qz̅բfn̍UfP2Ԭ5գf.Ԭ5kDQ6Ԭ5sfQZ̍QJljVfQZ̍QJljVfQz̅գfn̍DPbԬ5;mC͊Q2Ԭ4%kRQhc icS&-AnR_Ƴs?QQԬ5sijVQ37jV@PblRԡ((J#R(.eRԡ(nŭ)k(JR,BQjPFE9lCQQ2EEQ(EDQ(e(J12EAQQFrE)FQ\Ԣ(nōT(P2E@Q*P0+_"Yҵ)gʝ/bX_=^YA2u>KtnqG/ S k}s"ÌˌL2hAb)<\Onq$73L&7sl( I єry y@>:30sqGPge9c9w|e)D̹)WS@>{O 'L%_K (M>r>|^GJ \7"-&| un&_JeI|, L,ꬤ,U˹<[zs6W@f^G~+z6P"ĹbwPV"K9Vm)AN`vG}~ !H?{q1L5^v%;LD}7>xXx(/Vw:xI%bso9x o9;ǸS^ck56[17S{f=޳[ (ԣSO+Mޛ2+S?c[޴o7%M3xSޔ`M#7z_E Q> MIO| ep5 Or!o)x"t-m$s~̆9υ׶/K0kF[W-=7K͔/ly:ymةz+)Kx?޶".upΟA<υ9rn>7}ۊY9r^h 60/ ֶ>7ook nKaݖ7 ݔ{(:n?u7?^,x6mm\ҎW+",yoT(oux_׈yn}H>˳"C1R-Yde1(2LzF>ɇ |$Bɳsy]+2o'.!/'Q'(1MK^ ` d ȁp,̺?A >#\n5˭& -%W5o['/,@1ӎv~A .M^b.7X"`j#`2Lz> (}&DaRӎQt3ʵDyrn> X:n-e7btBnNmJgK>Ob`Ӵn8w)73u؟O W@9~i-r3oؿ7cfߌ3oؿ7cfߌ3oؿ7cfߌ3oؿ7cfߌOcRO|%O|%O|"}%Ro,?9D俈TYdvxcÞW!Öavͱ8x\͹y.K%1fɌ,ϦSB~Skn%p3K)Oeqz]}[Ia?_y7Stk8>J8W  "/E\blhFaZ^2{rS.1VX i=`# >-Pp'wVyil{`d%VF~/<%2MMO?UbYcz\ pe+U ^C:o-xQx@>P A#| p$sh"Mzf٤g6Mzf٤g6Mzf٤g6Mzf٤g6Mzf٤g6Mzf٤g6Mzf٤g6Mzf<Aq0IL4!4 Hk!fls!u |A.13' BX&X RHe0g Ȅ,pJȆU@>*m+ȭ‡GΡnaFnCnC74yJi5̫㓩d*>Oⓩd*>Oⓩd*>OⓩdTW7퓴n&ʑb^G:.5I8A7(? 4c}Y>ӡG>rΗ܏ܟ<-#6 O\9UWc'+h[NfEfRD>KCǎcG7먛Ɯ =;[5vK :v1X Xɵ  sNrW5)RX6o"Eb0cQXTouQ(vx1:~DN_'ѯI$u:~DN_'ѯI$u:~DN_'ѯI$u:iD'?H݋|CЩ:tCЩ:ttD6 m;{P G}|uOPn@Ч}j@Ч}j@Ч}j@Ч}j@Ч}j@ЧslC(t0`# z }/` 0ba( 8#`$0p` 0&dQt(:w;E玢sGѹDhV'Xe`q V'XE4h`MՂrDq7Mm 6u wnTލʻQy7*FݨwnTލʻQy7*FݨwnTލʻQy7*FݨwnTލʻQy7*F P!"5:)"Tp_Wf} f~*kҙy*[D:SjJ'3yհezb(XbGQdUŎ`Pjl V CYֱBxVg'>LY%VgN_\7NlҾR%/B q|rn qn1^P̬̬(\9cXݲWAs NrkUjHPSw"mE(ܿ(Imu@*P VwbYP;A>+=D!(tN҉B:QH' D!(tN҉B:QH' D!(tN҉B:QH' dW ^9+rVxjXᕳ+7fn^~(? <0<B<$TG4uQg^[Afh<uM34uVV Q煨By!u.G YE,gifififififififififififififififiFQrT.GQrT.GQrT.GQrT.GQrT.GQrT}ID_їD%}ID_їD%}ID_їD%}ID_їD%}ID_їD%}ID_їD%}ID_їD%}ID_їDsPa!"F0,='+ z@_1@aPq0x3Q0x"O0S ^ BT!*D "DQaNLHcYDz"eEˊ8q,+XVıcYDz"eE۾:JMڝMEɓP٪j%ZIhp &R eX3u0+˘f`Wˌlhb6e6l5=~KygE95]  *QH0hA"j<@GDQVu5x+^\JD#$Qj&aõkzy~OuO7(H5 N61s I$l}= ۞.Nu,Nqn;i-"=t`Jo`تRlU)4 W=.AK=.AK=.AK=.AK=.AK=.AK=.AK=._J9_y:<=RƳL|NCgWWW*wûݰ VY嬯_*p #YHx͛٧Vp_Vxyxyx2Oާ SVpoVR% 4QK< %O Ca{нaXa1K< Ca˰eX2,q ,arxr9<\O.'Órxr9<\O.'Óaa"3GkZF~ ~-A, @"hA4                   ъq   ;    +Y,Ja%˰eX2dV *8J E1111Wd8`k7k7K7nV7+B ^ؐLlH&6$VbCFbCFbCFbCFs9E"xN<S,s9EX"fVS)s9E"xNS)a] S(C}}|/AXbX߀[ |*@w+*X "Lk:lO`T_f+ G$AH~1hx"::RNni ! Os _ m. (DjYωT}.VnK#$bv29bk1$cN2JDϔЪM]hbO@׳Xm6 h\F/yA"hW튠]+vEЮA"hW튠]+vEЮA"hW튠]+vE.=P,vb; ѶBYqBf!W,D ѾA"h_틠}/EfnFfnFfnFfnFA{#ho퍠7FA{#ho퍠7FVJ:?~DXrB|n!>[hKo$D Ӓ0,ysgv[zDR(p-\ Fp[hp+ ;`,ww8ϻ=0>1E,_%k X xG2#{۱T`"Q .d9y S:St館*-&4dDVAdDVAdDVAdDVAdDVAdDVAdDVAdDVAdDVAdDVAdDVAdDVAdDVi* Y!4dҐUb<#`_Lb=!ly zgN16FJW&t3o0$OFv&:{S͞/BϦlptԶT\mSȻ\nI5{R=ƞTcO'ؓjI5{R=ƞTcO'ؓjI5{R=ƞTcO'ؓjI5Qy|`cyqh /Oy)a'K8JX%B!V"p!"o h+]~zl?gF|fgF|fgF|fgF|fgF|fkkks~6sD_jTHK 奴9֙ryLԳIqEVBZ]H iu!.ՅVBZ]H iu!.ՅVBZ]H iu!.ՅVBZ]H iu!.ܭH< r9`(8  Px(xKpp).+@>\׀zH2ꗙ>2besˈ**}ԷGGGp 8qN\'W+KJy-u9Zk}?يFt e'41W/$L9:MNCp-G Foٙхzϣ<=zϣ<=zϣ<B[* -nOJE2=JX_=Jj"XV'Fxౠ/@"CG^V3y88XaYLgKuB}0j?>XY'{X_ c8rʗҔ2rm O _~!qX$4U_$}; mp\*# i^s9~ Ɔ7 Z=Ƅw+Si)e`(_>OARЪ_Lr\Vc)}mz -{ &[ y H`;"ɘkr-揵b;;h}_ҍ(w=Zf Md%tįWX鼼 >DZ_3FAx5?wHBLJry3"nݍPrz#hu;S44Eolyp>/B,KA%bLo?j;rt6Φyɬ=-{Ёt:Gć{GwfcF =.+(o-Gr]t5FՈDKh)AK:DZE(Gg%:+ ڀft#RFw9;0#*EBHA*rFLp QZp ㄤeҲRZVNKtZD |Zku:ier56n 1:̊~-E5Nо$1Z7{Nob3K%aԥ)i2z'= <exjL}*iO𸻖]˕W5_ߎWUm3β﯍V?ՕJG #7?sL5c|$.ڻcg˱ݑ|,>ïB'*t }I,I,`FG*t BGDkF=kFr͝!15hK^s>*ŪbM@~) ;Xj-=/.vP(%eR"JH)i҇R2-r-gRRD7~Vʷ~Qʏ~Pz3&~S?C# xV7 %r*ۧ[oXel6V)AFf>;ѯBFh 1QZ\ ?W^UF'dp_\փٷ3jKЉBcཌ 7ڤ<ؤFdC7lǶ`Inԁ#uB%X-{hsG'g8oxM";R[DїO䙅7< =뿃G?.2>f''$Or̹Gg7x yClu1xmr%.(s*x44k1dKB!) d)[pg69S_K[@%Wnf |~GGJ~c҃߱ݓ["MA3-A+-^896z@:3#ݝc3l"8/򎢬lЛmGc)/:obtNż!c)GGGGG|KE }R V@=^ `bX֣0/$)<&c NHȭ}c_Y2P)hE33xڀ_TG5ŌrcfÍ*e ӂZkz'L#KpV=XAUJaUR$]RF c:i,Mlp]!YDddD NVRQIķX9p@1݅Zg3U* S2Uƫ>zay%}]F_ѷevsGGd$WxZԌ Fk"ʐbtVgSTF?7e^.a4 4 @+ q(fHHLV^ Vj(Jn$X@t V-HH禲hu8(LKK JJ괲7By$p28N8Fp\#A|{3 _A4omomomomom/~mC~@?f3Ѝf 0h:H*PJ`RIaû/j+$\i<}ԲLLoڪaE4"X ,Gj#Wa-&lg-bV*2FCu<9 IzQښÉfldlka;ZuFB8"wƞV 7%Ɵ q?g.b1ҩBkD:үR9i xLflx"r$);`A9DD"ZaRPRI2)ch=JEߓ3za65 7O?Q*U3,l!ZzSZŞ u 2vO`c^/[.ڑ" +]ӐMMm5#Q~,v -}!C R- f3႙Ԡ.}w)]Jߥwcq?9D  DYp̙w]о(Cˠ({czgEY:"ߝ"t_ݗx% ^ɿ U8"r+' lۼ4Ǽ&7\rs>JW*(mc|XL-;I׃Sf'd#fA RiAjw^_E5hxMESjT=jҔ4&Mj21Cmz 'z{9=]ӦԴ)5CM'QIf=^b2szo9)n4}mMcmPLQ3EmV!lj2T3ǝu6Q4:Cc=iAc=iA"yHdkEA"Z#$DDЭCP1n8j䏰ڃ4 ,+ |,+@%X VjP~ڠH, p88 VKtrVGw^b \lE."W$V@Zz<01'>HQ[co75>F 9LV詌B (x ^^=^fk:*þ^ xOP"6cf݌]'cWCDcu]R `Y׀`IΧ_ӯ3ۙLLV S[KN=r#Zp0gLc8SgcPyVt)nU_f?]}>s:_D~vwYޑ,wm7qp-#IoeY̞HX(y (EG֣11sS9Z&=Rb%fPB%ptGdg`S[&Җ%9uqvh]Z߼X}soN"m'5j'X-6LImR\-±Zԍ{`s06 c[05]N3,@<= cO04 `ͤ53imǘ\fnaff+{c\d.v2; 3F3:̈ad;FaldF01} c01}Ա\.v1] c0vQGJa86_ŵla[alaHM#|1ۍ6f[6*w6jF7fh\3rnXM?V&vj&!V@ֹ ö^+ֱ *~z>kM՗XU v@|I$+AJ ') 1W>O=}Jp7&j+{xorfW_WLJcՙU!bX-3odnjGb!ېm6`r 9?ck|||{Z:`}7ֽ:pKݎ0s9w;a|0s9vc;a\0s9uή zc=XĤ k={H S?d" X*vh ;\CSZBFY$F$F$Fˤm,픸m V6`j^Ȧ^XauyNvfєzz%^ɦWlz%fyN6Md;N6Mdcyi6=MOez*{;lz&+ +!Rv Qb/kmp7gnl2m+~NBjeP#=ϖA2Qٳ}8s(VMbsaa9vfAcbq9q+qNǧpzvx-(ƛٯiy09|EL05V”f/Wv(1FۤK;]y[/cccǫ.0IghB6?MR|xxI0ߟR)V K/b X L7zz r'>"7͛O0s4@G׎*m볇LTQcb|֮GڦS4WΎڮs٧fDzvXhY^-alfmdoFN^7ѐ0uYUl8ƄiLZ6 9FCfy/qUϙ3OkZjۣgeuNv 1EGΥv.Rl35LrY.5˥f+يq.rl].ˍ3ΥvSX֢96;6o5·eee|j_](1=fZϓ2|j\eX K|ь F\¢~ J_R5b~+b5Gίq>565 ֝-FKQ jŒ(/[(FfM:PήXH8yx21ԌذZ&63jG;s-:[:,Vl'| ooFgAhBvσV/ƽˮG ,ឹֈ :Y VP$ʧr?7"D#%Z"(x3%I6q8[y#.#%q(ft>c(*wQm5YM&#$Yb,%>^nell$Y9)::_,.kįV# i5zjn-**ZmUY!+bV)~֡lf.VR2ek)XGHWV ʠKi֑yuWevZשo2zBoRjQ{ڨ~oU{]mpm׶&Xds[.W}nh?䦻؏]GL===~vw/4tw{;½~ýʽ~m>`>>dNtIb)i[w^~~oG {]euWuZ{[ޔ=WBp򐄃G$_3',H<&x|?C&GoNx-n݄w?Hx/QӃs> & .L,.N\6`Epe`U𗄯< K*/kkkI%{v^_ .^z0gey{x$&y%:ޙޙm\Ķޅ<e+;{IK==xdboľ޿)W^HOۉ9;;xӼ鉧z{O>J{ z_zy_{$^Uz+/򪼪ċCB''%tJđBg%^ M.4,t~ C%8tY-+Bw ]8644o) SJY2񞔍)?'Nh3I y)"Wn˯ױֳ,`7b?$j{g?k#FGL.RUK5֙h2~/z؄Jz>*f)fJ});3ߺQ}?ػ$fYu5IG6'*mȷ}eM-M#bGHtiڽYhjVXelΥ[{V>ki?, e|0z>k`r\FgΞ:c=n5ןa=7+VN,lmI ?RwMgvz_7'oj3 Rj)_1$'r\[c[afV=wZs7ZJ!mS[wƸ֦_ԍڕo{v;Z࿩ɚ>k_:Θ^^A_Lx_q)bMQR~s+&ͬkCb|2?S~H2dS_q@OԶW0H{8/mH5=YES'3''kr0!,Qw[e[Ҷ*|Fco~^]gms ̯P_~ͼA=]uFL?ۮn1wǩbKzA=6wc{YƏnu/ms(qei/v0V*v8piu&viZw*[gՌmшۥ FF]\#vZ's\إ﫺,Iߥ->Gj6~_u|Oᖽ߾Yد͹ScLiJ?ſ%vec: _61SdldidL8eӛL-fN"bg]>ߌ[9wŶ 3ys%~dSfab:$&FNkt~]?@e/}J)kuU̻{8w:Gxӊ=; J:à;4m9Ckqf(T?< (+c+[{mO׶љ[cɯoDH֭]; F){lֶ;:#(Wޑbh]V޺5?vbUuVmiKlnq"v㺺#OhߜI{3 AKcdҟxp\_c*X^/o%I8v-N֞ㇽ}W0[Y{cDN軽X[~[\4WC}ͯl"Qϝv䝔G96\ߏ|gQtghW1Hh~m+1ө{Ĝ 5yT|2e(vt#X_L7vt~l^0ʅ皙ӝé0/bʉQkȦyZ}5z}f^5ljsGy"}H=B͝SU̙_Ei/ L^>{fRM/QU;gz<ϛ Kjx,fv}Q'Zs׎'VǢ#bw;#ߚHwGq2\U;[nߌZ&#a=3=W[lj.6iƎ<)~^6=a6%nu0cNkz-6wUlmx$UQ?޳2뿾M"]>{:ǻ[ b.s]oϰD;6/ddzg0錋u4Jck[jZDظx8]%';=w!4<1ذŖ?E=g4#ϙBm̢#V#b֦і/5.~03Tw tV ;v߁^s?oY FT-7=V/2wv C=}_u- '#o7Qَ̿E_$+ 5cG\B :I,SmDqC,*Ŀ%1WLJ\T,KDk?jb% VKrtn!uuA?hf]nuۭY2kuyDMƘ'nhryɝ&5O4+Z8ٺ;im8+*9W8WȐssLqwi hSTUAUGy*TTUw]~zrR'j*aj\!WayrN]/׫jܨPeWk[~UjK5Oͳ7{V-OT+ {ZV''a~T;GUkS0NS_3mq݀}yenjin'{{{}yEyn{}{=޾bg~yţ_ܻ'{܇O̳.J"{;ɝd>>e/tsttߴݯܯWx{~ƃT?{›dWxx{ySUދދjccʛͶ>>#KK{~^?ި`o C'ٿN Cgr B.Lh8$!@GD[4bI1K#фhjfݿq?['`AaA=,b"KOwt,YQ̴)b%)_XXAetQ,"m.uxOL5bu-POY͓n%=O,d/R-KGLTPhƢj,ZO?Z&|q%qqj$,k?4}RVSHY~V HZYD 5ְ6-1ORk³dA+(R,D[+dDb6Vjk}vV;qj4kkqB&J)p(RM8`k0g?:'MySʺ//.#9{ug޺dG[q1ݺc&!''E')izzV[.ֿyrY@;BXqZ#[ku:qZOkdD&gEE`m6__77~'|-mqL e"F~11"CNq2>AqdcQ(hg LDWIxCtPt |%:f[`A`8,PXLWoI/ T#+6Hē PF"i,w8-HtZ4<#"oN;N8Dy}vgg(YY><'gr>"3M$8ӝ颵3ÙAK?q>ؙLJbl3urlSJ|\,/E\|͞8 RZ񭳂ZU:hΏ%%gTs/f}eTOd*IWU qjZcTk}QGtPJ%UPy )pqfWSױzrFsCj%M|-_y'Gw,]?'HORx/Ǿ)ToF>8ˇ#j9pE lϧS~>#+UT99 P_Pj!%|d2UF|R3B4#F(ӌP֌P( il OBy8@?'oߕ"I?-MXiiBܦb4rEm)\ r]q&⦈~sS?> #ur; HQDw"gwz}•E7͕+ωtw;Etuw'LYӼY7 if|Þy{DtCt% Y}Ӣ"SiqӢ[@ca V-á:>t@ЉGhPh  =C'њY!o"=ءйs:}>sJ8t % G?󖆉pͶ[0a4 5 {a'cv0춆a`mvKê[rg[ _ _o_o/4+v:Ruu%ju%~fF:NNhlzpL#a,ƻVp11uu,}~V?Z'l}uߧ[g"fDgRYYsu.aD- .dkA3bi_K`ÉZ['8"h!_i"}-2`"+nnFD)DmmL,M;;Hi1CW3 51&fjbsMp|3kbL0 盘a41&f8 &f8 g,3䚘 3 11&fbb3L0D&$ql![lJ"J*2tPl+|w&!{>JE,y8G^$/;ODy|fsrEG9INI,ψSs9A"_U*[ߑ{=)grB*K.E4B g\%t8@?Wd7n*:;`Dbn_GGGGmmqN FzxIGG!7EROiDJ)9K݉>%3^DM_^(#*\XLׁ#j9Ul;q:P-~!gs`h-I$݈~Dbn4'݂xLӊ,DeMTDeⴅجͺ:N>_Gb-M ܹι97}5'k t`3@]mMLuZh5 &M4ZةoߔcLDJښ 4PB'X5 g}|VLs|Z8dZe^5 dL'mL:+ȤLTgEuGɡpD)Y&Jio>puobUUzD,=MĒj" "b9hq˱D,ag@rXz%D,%D,P)-&n9-&ne kW+W8u 9תkNvhvګG=|&QPQORO4QPO)yb#^"e2{eJ^SAH}E)k"&Rg" MDJa)0R)3q&RjGTJuNWg1R#MWrjD-!]}M{ҕo#hbfJUEut䨟Tj%)!R=}fPh&;騩T\$Z[;2SSbZA)T+7%Lլ6j'DSETLLTv&>:ju%GGVLd"nή#+'.jv{)/.j@ :jFLu2!jJZWL|=ÅEggR\Cݡ%jfbVZ#I(e)eh&:DYڸc-ZMbȪ(D{q ͷL4~~+8(yrsHB`S% | ?RũCpIp80X`5'ADgOzR`/Ky)^ Xg;;^[{x=ӎ٧w49~|"Ҽ33A9ڢSss(:n%NNrzcccw/qcGA8o=Cߓ'&n"b|Ni"DOᑉ?}y<"//o ^%YU//,&&bc"&b2c9sH%ba"L1 tPk M]D P]ZeJUW|/OY)N!7,J%qEmG]NԲ7g`?*vZwcF䉻ПrmsHK|zt\=1TJᾄ}^ w:j?iΙw$j\Vu؍V[z/"k籙g]]yR]ړ㟠{.^?n]zG B}|Mw`w?lWϳ7kOޞR^{O!el{fΛN^*׿LM*tuk+Mcw5++D>~w?Igm t HX]JHsiS4,<: 2ЛB0=JG=w$g^];-LII_= OUZ q6`_O6K:ޮ\.cZ)\v"e귩S6~W>SI1^g`3RvXӣmhXӠDHJ3vΤg=؊ݨUQ%v51;y2n@;#KG-9E<)Hob?#Z9UGryR$V=ebYYC}nw3vZcoY=cpO-g]ۍ],w}l#{ϻMqwʋw{R>ăe<rgՕt&(=ztk4_:(&2X- K#۹gTRJ}ΎbJw]߁ks?u+~!텥-lsWN%ga"C[/˗ Ȓ%]KNSE&c8ZΔE^lO[ 8H۱vlq$R'ˈ\/N_Yrs7Pvlqn&|lq~Gȳ=v'].߸ߊ+UMjcq~ӱt,FI 99'9|x8yd䇒$O-Aj<&8wl|$8wl]wl]wl ;{u !! !.!BKKC(%`B11!B( ik$BH#!uY?,u)u]RBYJ RB]RJ]e3}y||fݹ3s{Μ;&6{DŽ1wL= 7J=Ax/_b7a9*qL8&ݘuc;]Y,ucb1טXkL,-o$6vv-~# D8C$\ \b$\b| e'AF1Ȩd3P&,C} Km&fLO@v_²eE{){F3<r,GrrFR,5Ԃdd$C<t eI,QXcq>[8g;L^Ym')˰3ܢAW@b&D`Mx4ajC4և `}8ţO3X7ź֍@7>D8/.%z<]X3h@[~UЙYs&h 9P/_t)X]:@ 4*kT$֨Q:*1Ыxe$,;!Ѡi1XӞM{I}b} ˟օa{k݋XZh/` uĺ';BcJbJc1oTJ/amm^dΝTh&k& G-} Jb+cqfH^WQS7boh^cQh-~۱߅(A\ 9qc!N( Ů'c{<#v܊%ىE5܋݃Xߏ݇u>㱿z$} sTDGE!q,N''W3=Ra{0GG:?q9rp (Dy<j99cS/0R'&  @뉀8)T:q=1'P> %aSP@myT|*[@~D`^^%)o:A_|0?èZ [ju>0PRX? D5:o!R(9Ob -!Z[pVb8R,sĹQ871E✼HsqNޓ8'ɧJ*A" B)犇ijߡ쾪>/7ܗٷַ d\Pt{Rro/c1}Lwoz $d߶+P---m*zUބ^髂.&>U`?xȟ?4Y}PgB\H5&y{opI˾,?ٻ 'Co@S9W{~~hwCoMoWg?ח'U<:H   f_3P?׿:(H d^Gwrw%yܤ7Dw4^{]q:o)!/ݗQ\W!v75%ۗ)<{܀JI9N2} 3Sowb }з}}>[X@^)p.08}w!}0A_[/1!Eb߭?p"i^Fv`6'9ھ+ -w@p}! Mּ#{}_g$֥^)w?o&X?O?/- ,vzW_7 R2G!N/E0.Tk\g+M]F.cջE~PHhb[0H(h/Os Ѓ~u΀` /go3yqI\*=Sypv_[[%_:缭^W zk.{#a̳A|\۾1\Zs}m>pYܸowww7ʼ#4^ m}{77M" И]nۇd^wWqMAj@<`ԹKA"=Ю<r@ Y?=&Wύn4h}p=Le,& t$п~0%g!Bg"eDO~,Yt?92~N0xx_$牷[B s9*D4BhC aFE{{f%d.s/-Ded:*[*HP-oՠ:쭫 ~7_BtkN__9aڏ9Z A} {,:t#cACnA  E >f Bs1!!=#a#(0ѨGr0*(*.ictOsI ]  3@?~Ris-$/E"-<#<~OJ(}=q4OσYџ<*0-x-':@EDуE==DTFGoEsBrh[B/JpHB|D{8caDg }@~`= xߖx9Ee+`[y<1C].P-T 1KKK|:97?QT?I}"_Q]j%S_ƉQ׉SߤI-&[ yj'C?"_P 3z Sx'W/ k/>Gn<||pf Ox7H7AƳDPG>g or2(&eVuxkHWi $1mM!XRn4M¼}`W'_ {e\3WN=ޝuWkk\:WHq? nSr{]>l{'}c =|򼥽p\w)pM 3Ĺ\l$Xgfqf@܊K)`,=o*-zW[% ~A,W˝A_x !˜5AH^:.qx…'6_'%1B\ nAO[٦w7 M >5zL%͍u+}Wzz7zo3,7+p,BKnF!؈ayS<ʀi0=^CG =~+X2*(UDNHN^#ț H#HhHXc~j82*~DԵI>Q77>M cϠ hA4MhCFSZz0kO|`/'3]F?ŞZb>q*:(#B؟/DH/bA<}$}b"&'D($K1"9%B~&(sY=;]-ƕrjϩ;z7Mq7i+lj{g wsi)fmEd7@DN e5{qj{.㦽Dnso7^ܶzs#}o+v5øu 7mݶ:=.͛9lE|{m^;^[6S3|e8sn'Z=ƷnųyS{H~;gϲύ//uA<E:w*{>q=p77ٱ+apv j:;lD.P_(w ㄞM3gKWWDnMDVMy jW\ x9/yw{׾uz"('Rw;Ы>R%g[lz^c{jm^ "^ 7Ā#<cm7;`vmڥ02#=G1&{܌lw-PFRf1fJ\a=LO'HIggűY})F)c!,s6v Z?` s;fC=NlikcW\#Ӽ rztg4hs]ntBo mqpaVYVhuXs}szs\̄i8 =G! 6Wr.05sO"&I< WDG"{>N<DP,"@LxI|&腠y`"8 ~$8BcOGG%|4((qi|LxDCJU<%N#BƨVLT[82(KT.%>I'aᣟu3껄={Qs~0Vx ~a9"6$Lf_f#,a6m1_nIܖNXGL$%qM"T^D|S.}Yh&nC#viw4?#'pgpHMkd2%_i6q๿!?=y|<%/<%_/Y_5>K_u>KވIU|F"Ya|V:YBJ1b">FL61bR{?$A \;񙇤,'sI%$$T4g0ISIT8i8i8L4Q9ˤziV!@*Nn>SU)$3[G~g ɿ:yg ,Ty<{#'ߠ.R_&I]B~ >p ׁx Cjx DZ~Jޣ><8%z xze{⃒7=TS%A=3oDx~A)1 0-2T9$C嚑EA16[#Mհbz>lPrYf?ņ0r~kZa2 [R%g&" 5|u {Ǚ<5 !MCtDU:RƿB-%B_ v{0K/c7M&z Y@2LWVDLML1-"r.LKtibq_Ąn&Yv)e*DRizKRL]f5nʧ*QL[v$f46%T "P]mQ47/+J -c]X-6SxS-sqmĵ Z* \C!j*kX1AI$eY Weж7f¬Q!6-`RMAr 5u(!dzdPG@y0ے{Mijɕ$ ruCiޅك,ydB:j1˧,TIi2!iH&ۀ˖dٰYXil̙Ƙ)ӆƷI*!9Lt֡E%!m~Q)Z)\Y@"Q\2W懺݀_1ԅ醌 Ҽw Y,yR^Getz?MEYђ# ׻ UQb%[.)7,K|J|Ǽl6myEhc;l; 5 -~eρ MHUB Ҽ@s|B1c% )54Uiɇ/7'(I b[s%M~O3в$NLW@NLp9*kLmFK84쳨-bRbM USe5OJB w"~BQWLu zL0/? Y#::"Jog%G>uDUFU(iv( Cٷ({Pwp4A( tMG}Gp$>U*OU|Sا>A؛`oJ)؛2`oʈ)؛b7eޔ {S؛coG8‘+dpɫS #[|Ğ = q{"'(~NXQr">#䯃iw"q-w"p1՟ &cqLހcFS"7ȼG-82ȼGmQQQDGTlT೐ G,d8o8w,dL#LL8Xa6cpOE<đ?H-a=ogE·:2:ɧ#y|Z8M 7E~2>N䛼EV~yޏ"~)ñfFq܋}D~Gȯ(=Wq|Gȿ#8B|n4yύ&?q;8cFOœ+e%^VPe={YA἗eEU$_}^\޿ zx*pPP>xAò!Ǎ"8F ٫99n/cܲE5dso?)f,ooR~]Uu29 o jغXIO--כrز5S"[M=~͕%3yOs}hf1.W'ך~(kRm͙\vN(VhkΏ-oMjpez@-Rnq@hKg 紭grϥk_Я& m5L F1˜n23F3og%Ǥ1Mêae dJFҌrժ4Lݰ&WwB؅rMXTf4q!LB60%XwW#?dTCqfLEL1)933R m3z+\3St>CU}\l?ϏVh5Nܙ=q~\?/WpzeTva@o]A!njIC ̬BO!4r&m7 FM7Mƀiδhg5gjLF'ߧ#&ij4934ٚ2M>DwM7_Ӵih=*i5ӓM1xE[S|f}.&ˍ :mHݪw>>}-F=*w/gz}GھYS{[5Rq ӫ::\bZ51mfgH8f7rh0&If0MFS)72y}Ӗ1`.^4,`3*L &fhFt$JgY¤.]'P^y!LlWjfZ\~6_=-Ѧi #BuxmQA;>@V5īիmM.Ne.ҙkMkEjRx¦}w^}Q=9Ghp43<|gA Rqċ8 "K<$yI<6?G`^%<9*+Jv5|w]M!Kdi2`k^SޝѤ2\S[S8O;I aH-B}iζBt|qDpAtlߪVMi5ÚZ-<3"!Ω[j~A$v5ZiZD]& f,D$muzd$:ZL_WWNՆJ D[jŔ~|r7B#OK%2iUU^ZSp}νRF?cȊᒈy ɨ~Ss,HCr!Za-7KhT<0 0ϑLnUUrƽ5INޗID1iΆ`{L1 dnb2Q3o4Ngzl_8jE;DiGDs%oiN^NIgNKs|ɽ:q^P!*KQݚit cޑnm?%;[(Z9y@W?[Ĕ3i{ w)M l[5Co6 ׀⯘FM8T])[][W=8hJt`5++4ҍI[->"):dT ~AwP/ՇUULեj5 J;+q+GJ{#Ig [ug˫tFA啳X;`۝|kq{ښiSx]6)T+X;SYcL2 N>[0R'7 MA]"NѮJ7_ t[҆6.Ӆ)i L$#&6za}q~H_.I*vASA3hfF\i]R1k ٦S%xsr>Ax 0\͘fIm)遴F @kӓ%2 M[+I ?qdkun:WL_+҂j1YzJSiVRǴj$2:!Š-:ܦ&}p|V^9}*G+zJx,F͝7Bʇ }z_ SU$SyT1+OUfƪ6^s7n :fhfʘ)04׍W4Un8*jI ˜r6 )9!uۘ ~]}&];q15 *9z:}m#1q`Mziqaq[C4ɈtAߖJ\i{~:P-[+9*>񖡲|S-ʀG/2VĊ̪&.BK5\ejtYSnD\5)* te5ݢ*vo~+ltن!i.hg0R)'3L1LKV sEZ)xw "C0< @pɱ5M`MUyչk7 &8ujSr\[ĸ`A;Umw z&0ttz.xPR5^Ƭ<7sXk27SqƂ3jAgf+L*xŒP}IIQQMɚLKS uqI5Z>K-4 k+*ŕb~\FU~2I,\Z%ItidiucI>K{NJKAmڥ&=@KuNj)x35riD(VU_mucZκ1)'Y-I$)@A)aLixC@zT~ݪu魆ڇ'٧W%Ce Rrp">I[Z q9w/lk6\G/.ء G6_XODSL?+\_zi$ $׈z%_by7y#տK0MYʮ70|Brujd:D֮)sPMo5 Q#LUIÖB6ʿ#AAΞI3ק2Ffʦe3ťW&l4g447lnm\W|y͚ 9ClpFEB*H< %UUC|朊 e@iS.)ה{* S6T%ʀʬn^AZvtx8c \A%M-V^..jhm~e)O%CC-)պjGV=T TSS)2閶ʤ v> V$5϶2(\Q]T{N!mOV꺪!/Z+BDL{Qs"A^^S+U.l)mv=P6 w;UV6$o\VSvNi%Olm[A[M0ueE|>?U\-ˬ GhQצUεݗ]Q(㕉ʔpaٞlS*emve3H1y65ayRE5ĿNNUF V2ď?R6$ՀrFդ UJJuIEt[˪۪Yj\R%)B31e.U3y*U9'Sڏ[cE'__.h?Z\\]2[z͚/N2_L,,U*֚ו̷MiM/\~yVhUhkiS.~3LY.+QeT9*D9 @UvKS-+Uy~KI+۔N%Ur<@uC5yꪲX٨tl,סk[-% {9^B,LǑ9nٳOa i1p6gc Y^z[6'NHp>gKْ-)ْb-ib賡Jυ>/Ņ YC_ }QJ C}YYJ澸K4>3K|f2,M3g`i*,>K ,#W%'yܛҶ&o!*lees{[voJ󖲫YmVvmQmoZٕ-kfWJ6q: NRS=/8Eϭ̍ʈhۗnޓ}8c$֒)3O.YYҗ֑;Ei;[Yr:#vh'R w/1KzJNOѷcl?>~}5:z}W۾koyh-nޓ1p5AZCcF씁:rrKf-dd,niVz{sGXES -]siySV.7#oJjȌ3:H^ߜ {\L3/u1)/9vnT~w V.V"%U{ux'hYmpL^>Yc3O{YSڃ2Ε}v3Zi~^Z^ӋN:<#xsV,m?vZ޹rK6wϯ_g670{sznFlpi} W>#!VsSJ篚/=7-3Jcjlf-}K%ovzY:,&4( U:&#iH"~Ұ4LS)2F:#!Z9IN"C 4 2t:IEtDoXaXAB + +ʰ ݆nb2g'F1g1D5KXf,#d!C$Ǹȸ0>l|U$Xc!:ci7֓c<`Gd dM˛-2cˏImLBBBBo,IY4)?]ž=_m'g=+\ eW=e5vƳ]`W+<Ʈeų۳Y3=]췘⻤E#S')Hf s~'#g1z K6e{{jf.#mfF$.{=SK6M13-<ÞN*M9Mv&+MQMMEMMM5S<8T}}Rc<=ʜM(YOҷNm&S: 1ɮ.wksVvئթV7W[-cSgYDz%l/h~)ݼ.fvl=<5y'#{qcYC|#ͻ},OFuљs'u5z24ͳdǁТՋ-q_ 8Д ON:`B^h-^MsS3ˬ#Íĸ&{mM{FeWl7nhj:piRfVO=>}ӳ)3jBBB,ñQ9e_qr%kku]$2rdj ::Ǯ66Եu]uq]`W{\LqV6]-wy];->;AqQKG!אޛL>}pӜ>(D_uj&5F ĹcnO.3ޛJ͟O$jQ[&mq}+jrk$L3vGڇ#M+Wo-,YWD[n;}gVI}vg3%,S,f/rw{mrVlkOuݹcͤ5({D+ kRΧ-9E2wOmyrpob6wq9gpX{YY~Qq{oֱkbd\sxzOvVSn541;v~VK1Wbo :R-b9Tkpq#[s$c Kd/s+zK%gꏔ6lighٰ]Z_.uڐ0aina]ZOe[`0o!׈@LLTmWN;}IMZ]Vת[&ڴ㎎i=i=Sϲ5Oj`u)Wl} prmIv; -)}%:"vbwrLrTkę60kTbnOX@G҉Y7F>I7954':r9ZY/BduxZ__ ';VVp{YwwWջ/װuOe4;>&GXl{b)f/:~k1uYl-R ֥v:R]Zb&5Frm˺\ Ӝw4viڔg)@Xkd%8>LZssw,'ޘ[?vNLbnG_p݌G_>XXmkqOszOPJvӱQqά)5Q'R2\`r]snF6IJXaYy?d#~M VשjjK:YXV#GXgmJp}a#9= E qޛcWte)GjE뢏O!YgbRZ,2>7]::k$벣(&wŴS2dw٬i];/vtWyowmsT~oJ̬kO8;'nIZ=qM|{b`v[ösΊIQ#щg$W8Vc*ZY?_Nr]l'eQ؟-pÕlzʃNYGe9v%Nf3]鮿H7Dg&83ə|:TDyʶP+DNT^dɍDvtLMe:n3x"]vzu*<)[*WU5*;Ѻ9,ry *7VnfM<uSlicUr䪱ZV=6QTw']֬pZ#68j;Nr$Dw֎FUqur#{ɺjkPҥ~GiMG∍iLΊE55—WJ:ft%tOZiYHIˍnǦ:+1}u-Ѯ؜8CkVCyuZdrY]Ll[]VrEL-֘U_늓ˢ Ė<)p|[3NUχ[- Mܡԣl^wr[%fs܁[׫Mɕئŵ ƟέuE—fœճ"6:'vm]a]Uv}um-/ӌ΋IqyYcT9+KFr}|SĶ[ǟ)X6Xۼ'%]rGu_tq-s.T*Ngk]t0dpLtgҚ-)WR^J6'JXSI8p]`bkOi֨kE1ΐ[{־82c+֤#OYl}Eo/Mu UYbs.Z %#u;:"j#v>^-X [V]n}u.[c;E#DXj76EXjۦvvXuuuV5jVm3]Ӻq숍qi;kF2'D-Ď3jhJά[[wYNUdcB}l eUcj62wE#fbe^K-th*RR;+wV,_Zq*u=%7coYo;2Kn&+T'e*iZu>!ՙtY®Q** _Vuvӹ*9fOՉi'koN^^]Ud/L&8j6V'  KZc͉8Trc؞(WVݚ6ZM;vZZ[ml|ƯoJΊ;j ﱖ&YY{a:k:Rc;:Zc7떧-8YcY'lj[nBML6_Y9jͭ[VyVLJ:b|56'<gHhiݬ:#'Zڤo~)"#/io2&钵"l]ŋz䊪5Uk &Y;--bcP*WUSִ֔ձou̢-+ɢpbA1 ohZ)vnC sBhMk/&ۇqիVUo5Z}u~al$oz5JalTCN̪Ն]qأbkF_b&fsТes_5+^U6TU^(&$֜ZYMog[aMTc//Zw&1j44q}q_?4]ۀ{ΙJ䱧:Dp cq'HBKavu0n]k:vwy tc.ɮ6]]x][Ůzγ򏿬/a: kL2|s=ڵ쳁_>ZfV n>1ho6! /Bk;اTgҭ`$k[#,cIX`,%vX L@,R a)Kȅ@,a)0x`)0ϗ_o=ߥɾ+|ݟw/˾/o\zݾw߿,oo_w\xuz4Ś:1h*M}*Gf22Pj6h6krv]T3*L}:\ >C,\v֢i xasy.j.l,f_kSSH ߄߄oo7aMؙM&MYMMB&&l~A&l1~ ; ; [߄oºMX7~ Eջ$YՐ$V}ߛ i)-84gڗٷ*+~]w~|x>^2C ,4F݌x^v{}z_<;Jrc0<;ó} ώ8> hOGԙ>ʽ,?.(UnNs1 (Y_f}&lIe.y89i106y`7M@/xx 8@`&zQ ZҢDPH ۀHgt,*$< i>d5/#,TC 25;wo~ x&?3oe"~ pw3+ 8X8ogw#k.DqnVs@/0`^8p _e\/S@ p0؃^+ :r+8P@䇾 \DT7_6}Id+QMx?~4x?GPۊ/>\=JRF|  :ҽxt"bA" urc7P޹Vl_8o!/F "5kKH'K<(i2T~-OEnsqv)g !z DU(HSA*}Ka>&p1p.(2'5fDyS/!?&t¼z4Г_>QWp|(jXnH0J5xKoځ[ {_B+F()"o6!Wc'AA,GLuf3<̡0r:A43r/a›O ޮ)]y>^U DTEA h5=?pQ*5ziAX\D}\= `ŘRj'EE}o }'Q~ IqFOb+O<bQ/ w='syXV|Qt9qYS3zsܭAEN: L&mFb fLZ.wgCBr`/0-QK,Jo~ gҺDLcTK-^{JigF8B>\"`iŸ ?yF|GӁx 3_Y< Dkʷr]*D5"1㼷?U #Vؑ=ἍU0K`, S)u#M#%Z w :c*>8aQR#)jHb@+76 (U GW>O t:F_Gڄ .). $$v18ݔa<%$UȕwkVU:.I*QkO){HFHb*jEx8'!Eۀ(,$dg!?ó!9C!Eb:BS@_+XGL!gbE b}$R(0d]!F!C*QBO!|uk+YB=.c- sw'b%ni|aȟ JkOM&p|W~$eX) ,;>!RO@0ŚQK}Me$`(pVe 6bQ;ag*E#$gyPHBfnk1ŜK+ڣjb1X=~ <oWg%J*]DNGz"0yz 5)QLXPO*V⢶1w+b,`q@kxXG)`6mPsd1Xʋ| @ļD"BF{ɂch}}@^б SP:k *}HjD (_ >V EHbp)>(~(<DʐeԿ$P&~p>m2*MX#S1`N:= -b#Ѐ= |ruOa!?ЏQ+(4-BGK4;*i*8旣XoyD-B9N*BYBI1! ,S@@(rB"dZRHy=QH 9)Hb~:T'bH)ПL;<pU5T!Q3Gy +H䊢# 3}w)G*JQT̃*j^ zQL6Ny !c\=qF 4ƪ} W@9ЊOFn5,v/[?f@G)23 :4N@@@Wُ#j rF8@V;'6p VI!A_SE2 U{YM ؽRзUZβYFVRбDh xZzEn_ZEVh6Qѻ4S4bGڸ-YqZ2$@Ny @^U!jG:eo͸uJVo*jLE+YuRGs=(5b1C t ƲP=@>+rF ^ԏ=V:v1(-eq<\E.AX,k ! ,+z5:ZyTWtY"(އ*P>\ NʯY/#OEp+o@>_Gy_B#pO! ᯃ(o tgJMy&a@&!JПFjU[S .ų}6RPQzЋFj45OAM!<ϾAY3,[U`ǡzÈVpC@n8^嬀& "ԛF#X"0G%؈!AN ܆Q0AY](#V4?C?yUxLb>ɑ[rJ}VF8g125lW^*0LrҬAu'g!@Gp~T`*Ҝ &qAj9 57-P\QŸUJ_ ~WCLHm>g "M\ރ= ݸS}m0t:n[haHѰXߪ,xrqvH{# ߉㨬:^^mC=OUu7.Lf p*t;(Ѐ;V_C/]qg7P {+ 0r*,=SV? \F@Sc*@wKa26{<|K{U<'m`yf}`V yȕ5$=VR7 <h`@x`9pDAi*k W6Ԟ |Y#/ﯤtԧ x3  1; }.rdi چ}~SOw`؆qg\`D?aZr dbwچ?p; q?4yE:o]8`ce睷 ƢEy_Rړ#s&j,oeXFYG]<"b #)ن] lmy>vR:lf5#G.[i6RNfJq\&wBچU࿈B: ;Ur8HMx#j;N= Fq}|GyRS>;ll!~pZIz!08iG4?fx!Yq7a]&!GH&=OO܆mᰬ(+bŴh5؛}?⏉} G#된WBۀo@Ld)tLS_]N?hzU@~oFhUhTIX˯UhA:W&AJ(yy5"XMuboY8bn zJhC`"yQ=cmNɡBo t˱J҈+R^@i.Ō9a;e[5cgZ+Lj͆@ӢcP~.γh*~ZрZI{4h vy4ta ƻ>uoo5EX`P,z:S[Wžh;ԅ^T ֏~aV#Z@fO:"wc ޅKcԛ=wͻC{Bz˱ x)Yo_(`'_ -*@дʿ ]NJ tj.e14RhB( t>gQyw^N$ڽ%2s$.+'4SМ'/8e<>P)avydJI=V@yt;Z Sމ9x~ !}C`?Zy8]m z.P3bAo;>?5 DWB iv-#FhaQv i`(yer{Gv.Ɲ& ,Wj{Yr(M)E)T1f5!M*NAε8.?a<7wG."]`G9q^ N]i BY@?bZɑ@OkÔaՇF8{)âD"4QۧS̞2QKʚ.+Oa)A=h{; ?aR;Yne:X0r\2`'G6 <Ƒ͹:VpOh2:HJ:htuЍ`ٮ{:+Κ:A]kyvuطauMyR:P]˩%FPxUcٸ[YAQ& !p O|2rÁ%@'bJLCP{< @}cL=12g}'JtAvu:Їu:alEtt:XYS7]@N=ժzwQkj,ywU;LNpN+DN`a:OyfW@¨Oځ':WM$v78._/ɥ@怎ȃ,z~*! z\ wŘz4q0dSԧ Ɲ,Dz>`2-H"%OR"e*eEI?BaANt' y^,Ku8@lHt`)ȳ( z$T5cVoQQ{~}PC X 3 +aX }ĵ.98RuFli$$qvP*l`4aۃYRI!K_H 58v:؝_uu8wK=ׇ6X1R(F"B$|>QBAA>%pI.p \8D>1+7y`K`}~6:XpV 7KP0 TXOdđP't?f1MޢZ_qv@9#ְ5hlG]]5:(u8IJ,0*,~3g4jX#N@ yx˚8gx0TQ*uY^:Ƭ]?̏mK3o·v}V"2aٌXSXʰ dr)vhWTKgępd)g錄 qlφ6Mᄸ hl6 gml`ÉNvp:} ߆Y\;6H&-P66^Z͆6Lp׆66ͱᬁ l8+a {(60 pʆY6M,bA`eÜ &‰ r P[D  w?T^C:sl1ml8mC/ 3 цc9\dZ1FNj`h\`y NpNku %mᬐ r 6H8| 1M.2J ̆n6#D2~-`'L fYp+wn=5mUqg 54cG aT_q wlyXY_Nߪt)TE5u7~M`қHqdN>t1o{Aݷ6\=:~EXn#q>KuUKʼn0vTa9IV  XHF0_M~XEJwD|kaW aۆ0x{%oQtt[`mm8[;j 4c£ F-7:PZ/?0<{{PBJ/!< ( ;[U .BOƨ`K,@|q"#E&JIF{!Mxu(r~Y.%gLx}wY|=<@$3S!G~Fh}Wĉ  yWQSՐHu.A$= UPD lT2F4Ejl;{a~(qvf',[n!MH8%]DeqZz!8',Z;%/>uNY9%x(G-F j)4JWKQZ |RmQԞ7 %x1 ?ǽ:~Zc_ y2J'?z2?J(^ %ե).GH >v)BJKR] Rx{_dKGR7^ ~2|JJKᙗ¿^&%x(~'%>){/J >|)+% \)k0J )XJ LRa- ?}RSt,m%y/F4B!FY4$D:42<@ /&MZ, "~BgDd("RBjHy,!O`Tğ(¥TAdY\R KI'Ks"%Fes"I/R1$DPb'SH'd!y$#uC%/#2İԒH&Axz(ѳRO 8L&$$ET&Rn"m|@#LRH#A"*/zLd9yα(+@ iY*'Ӏ9B`fIl.vWi{}!E-JG(`<LfsnoMR,m.jOCGCAq04bˣu-e5M(UF  EGVX tqz YZD] ܻVGǀ'l_1H%Xs`ԟn?acad?`PO$/ЉDa{&N>@32%K,\jI&+NKԟi<͠h9m˘L-˕r\^#ow|N**Ůd+JҪ,Wx!)\'s]v]3D ~ҧl٩n/sٵ{DzԠbrZG~ݹ}=cݹuu{ܦ{~_{?suw_sQw1g=Cw?_dKkk=#D }vkkb-Z Z.[a=*o뇊.z=׵\>wxCw߯]1u1\u \3f-\ӫ{I=nWknrDvKYRbW[XI)"]9QA[i=^%$xW$;^ 7XӦq:n׸~YlFdTVjm~< >:w,gG[HTOي}7{_}]럋/I_}1ObVm?>&;?q/{PWPOŝǝ}CFzSzպКp}ДheqcDH|ܦBHEI~ Hw 6LL^_oh|VU Fji-_"h᭟}%ֲ-Wϓ}VU&٭awv!G^nmIT/ i&}lt34AWZ w6AA"ti"/l:3 r<I q:&Ct>9A҅]mz #􈤡??oo$HCo~B?뎁*RI!udPɨzɤƵ;p"SϵהM)2S26*E(33I Li>bJ^sRƵR7PJ_Ii5JJHk"or˵ҷQZcl2EI6Řb,S)6YMt)ɔDM2Lt.H%S<&]`j1Ѕ%%ܴ}erttV3զQ( eb? B5;giCsоh3;hkЗ飡^B/'BoqKø<h5[cٲyԼټE0h~Q~%Ӽe+W̯_40WS7oʫ̃Cʽwk̟?66ߖׇVV*o + [9.N χ[ZX>b\ +_]\*\ݖX>_/ /svppA}q;ጌÝ&&p0p8 8xpHppIpp)pp8'8\*8dp4ptp p)ppSᦁeM ...5\\pYRfUrfcGsGl.$VUVeru>glӪNՑOO>cbqvGt->A> =ImK>NWDy?ὃ2rU=[H|\DZ^L%b ^,kbxqxxC#C˹'ܓsI8$V=$=I"Ħ_ఫd5X &)^qi"+tΕHJ$s%2s%͹ι\qDfrD 8W"pDfqD 9W"Ŝ+62CJ9!!-|sC,,< TqBj8!u7/ ipBqB9!^_/sBVpB Y / _79!oq~_N?K;x51;ó1 9>fx1nj2cFVkj#Qx]h ERmR6i۴.Jjz&Vv.^~V biY*-ހeV 9/`G}   8p>`$JJ6P860"0*0>XXXXX l l  \:pMM[ ?p H^x5F  2&Y҂rfUUZA˂ Z!hsP_Π=AA  :t&|HЕA7F`m>xlpDpTp|=85838' (4<22xuo7x@c'O |)j[:uY7Aui,]nXWUܺWL\Jף[۠۬ uutuutn_7-H}>QgB\b}Qߪ_ԯw{[{Aq~4D цCƆDDć$d )) qxC,Y6dC搾!CC92r*lȅK!WCn2!`2X XCa0 ERC24ژ4ŤՆ5M]àapp0bbni5*FQo43ciL52eb6c6[Kncqqqqqqxxx8l}*lqOBhiţxxxxxxxxxxxIo|@|h|D|L|B|Z|v|A|I|y|U|m|C|k|g|o@pXdLBj+G9xN9s4i!KN^99s3-gne9+sٜ#gOs9s9&嚹xn~nܺr s[=wnAsNʝ;7wasnݖ;w_#sOͽ{%yD^ ̋jkW2]^缮y=z7 u'a$,w w#"Z)X&%) &Vn^]׏eRQCUOGKQC:?gX7g??`6܋%ÍH[5(7P00ob[&4mؖmؖi&hha- kYX!PBya0d]\\܂܎܅|\m }u Cu,gٱu,jZb(yڑwh{%jDmXmDmҮxv"ztu`)h;SQT<;NųSQT<JŒn@zfdj(2,le2 [۴ۚ`9Xky(y(|ۇcACnAnGBkk#Cn@Z1SL Iqۑ Zxe  <TG Ү[ˤtXa^CK4Ԡ\G:ձguԯ~}XR9܀(1QrA1oa[mYؖmYؖe_mbkVk|GPAy&J2L',nY dYllmQ)AwByJ%RdYX?DIg~iMg"mZ,ۼ:p#/pOo6JoB 3V4x&g$X `P0p\^wJ@DF{|AFm`P01(| `P0]/x o0KX%GvA Bɨ@d9r8RO DB>cĹ| ˑCH[XGc%}SD# +vz?Wʦ][0oЖ%?’9-s8gNm p 9Y|uN'O"G!p -/GAV m)T,y@d9ri4*l54Ib;od,%e"ܲ㺍3mf#FJ@,b?N$λaW"SPCMm-ўFIuaŐqӃ$ 0ļļy>첟34b6'RKHqM] q\];6o"rE^\ϽmލSgAjz#d'bݍya,ss܎XQGjX*[b?qnUIȰ4,zl:y,xIw`x5>G3x*qVGm/#g"N192lo2֘5`~J"%v8vLW9>I?!*Vwbng &G?¿fb3LqYYh,ǖY8V3l9\u"C۱|<;h HrKiZ`\ԑ~+l%F]ڞ$_P'1^ ߅2ݖWP"hw xdOO|*S1c^Ǽ¼¼y ~챽mGhː& "=zi)δ&ږq<c'e`S,ކ'o4vevޏC]G@i b4lўOM{l [ `|iDKjhEnt5hDMkUEw.Kaa1Ѷ K\0AѲG4 J+1iF)X3Z0bȧ]!gLc֊a֊֍%bcNcNcNcNcNcNcNcNkakakakakakakakq88ZGhq-;#7^t7Ҿ>'䣞|ԐQC>Ǻl ېVj`XR[)V l-@=Sz п 8-p[oǿRo)[-EKт]+mڿ܂1r;: ,co;(:o:οrNZ餯;NC2Vhk!ZYVh_!7M|S[Sk5ZMoMnS.x`!Z^})þ%$xc ?ae1_u˱n9ZW8QC9ZWzQO9ZR%U V*P[j@mU us*kT\ U8ר¹F5pQF}kQF}kpb nrNI96';  i5sZ9ƜVcN1՘dlu2:[NV'cɉ;Z;8888888.VaE"lu[];ՓXvW Ln.vK1 l F;y1^g⻐v=E1A<{ɿH҇hr>LOh9}bY} 5"~r c)el^f/S[^^uVa&=4>cQbS}giSNMn Q4<XBc-y@08_cZht6MOj +"m17GUV{M{Ai5jjnnУMz!KכYPob!v-n,Kwg5^z/VS/KX- VWROSXC},kW][rg#e&ʀdiHMedUY=/jl.kE-wˁl,Sr\˾cJceCKFQCX{ sWJ]QUW$5E-t=?fkTw=NE:ZN3Yk.Va3z1s]̪fUj3߬7Yӵ֬msn604{\͇R,se5JsYm>n>ڇoas4cuxsW|B,u$]I/RJd$Od1YNVd+|689MΓ+P]wc#6= t;t{p;aZ܏Hw@1<V?tg0P#L`#1 t'~ie;j?wa3w 9=Sg>w|0‡ wT{;IOBß ge J n/s1Ib! |L҈iL'Uiz$;tgy/̿'YBΓ,7ZD)Q~d%/5Z:_ Q>+!K }N _$T#}ёV+N|O$>OS4,g|1`_D.b~+7-ykޖ}{y1uM M  ͳych ob?B[M9|Bx ނx+ފyކxx;ގxK`=J$L¡$I2CCI4474d96 As 4uw..^]=F.04s[-`~sm6oֶ-ּ5Xۖk`mwI|X;%4 k怵X{ X{XmI` v==V)XȠ߭v`zZAgS`C|5D֡]Ǯag?Ѷ>[*D/@A؟$Vh}:ZwGDi4&ꣂi*Bh: PTR*j h 0LdͦqCsiJéFoi Z9aSHz>m@қ`s3mLoM議﹍6hsڂhkz;v=aԙIлhvn^ڝ{3ho -R)C`ԗ>BGi@AcLС :>IGQt4}_ "+fAVb+c֏=6 bl0† o=Ά'$Fv}ǮU~r9wq7p/O<~ʫ4\: [An \<\Yyυ]WU~˳$ȋs9'p"_N |8*p.u|ˁW~\  \[h^-IKO_KժhiZ&5KH??я__Si ~VJ?׿/Ke;~U% )[zW&d"}RHLwd2ޑIC*8+ː!)2Kd+`v̗nثՐ5e-Y[:FYW֓eP$ɛecy 沅l)[vFd{A!;NSvw"un^]'{Ȟ_do,RGɇe_'cr(q" 9L>.')G)9Fr|FNr!gYr+[eMN$9YNg [q8g|m71.ow{qQEO WJS*4K R*"*SEUlW9*WTTmUU]UOݤDݪ mjjګQuRw..UV]=WuW_To*QRle6o7ۘmvf{ydv64wEfWyݼaf|,wf> G~棰}`=m9b5+an>a04GSs9|o}aZ_Y笯7u.]h̩t]AgWd=O!# l<O^ds9ُ9#Q|N|N>')>'{Mt|N6`?uLww|*==dFMzhh<Ē;q>&@1C%Ҹˁ 4bOܥ ZUC˶FD>WmHVnRmU[V:=11x b2cVM,}j@S @3'ji>$<ҝ1BE./@O rOhe߭j* <fZiVwԯI"Ҕq̓ZuN5^kh߯u`eiu߶Mջ9w1q?7E6dCV:j*W5TUajƩx&IjyjzN-Pϫ^?W TC\goݕ%j5?\u{7]u{wg962jAN${Ҝ$H{u^.?nfpք5##X ցaYg2uag}'gxy,7vw;rS`n+n#4+6`^ k]aMz6TiK%T}PG85\=fUiHAIzmF酴ToCf^B}.Q1Z= L)L_ }>}Y@?D_N.D@ߔ/ʕt\%_ yk r8`Tc=iGx>?·'$GI6a"fN{3L(אX;NS㜻S_γ:F0U%XAG~''I &ђFk-1Fgy+E`"< s sK R˞Qȍ0tV:V={whOA7X$Iu}4IFR6?@t#FK,®]h?@`MԾ=0s8ywdwM34.,BNA0}>p}b>+J5W+I I6w;HK|.;caE+>ppuO eX݁I*o:RdHLo7 qވV$Wo%yzRU[ߋVV7;;j#>UIL=GT?S 5B=FQjzJMVST5M=jjzA-U/e? Uú wy΀H/^a0O-e.8׷p䍠#eJɮBӜD*`@0`2@8 d??sis/_} o7DR?OJtW_ Z}_ט4fcUYugB֜ȭu٭v`ƱIl:l[ֱMl;NvF`'k/-ۇx>V7L3|/+o;[>?K\.e\W5WmW}WcWSWkWWW7W/Wkkkkkkkkkkk\[];]{wºNθλ.Aԙc:&6"www=======׽нԽ½ڽνɽͽ۽}}}}}}}C<<'{=5=u=G;D+`GI,m]D{`[*:|| .]S %aĽޢ;AqD@ {H^>~`(>,D Q(>&2@0p ,~(o b9dWJ!QPX!b Q!C#P(Q-Lj 81x8^|{FNSIb p " ~MOg3bp)&gb p +gtsbp |^.b11D .a^ |uD5`]QXO5 D-`CQx(6u7kJrB,K2K  ߟD_~~x1o[Fb5 o b pxI)^n0ׁ[z[ 6a?=]lMNKl[o{6;b;p|W^ͷO'v?~Ax<$? 8<.?O#'Q_'Sž%>O/g3KYq+W9q x^~#^gŗK,[8N| " FE¾Rķ#2L\r+p@׀^#0H,RV bd!.=*~/0͟L'~Xׅ懈Q~~? t凨Zd5`ȯ~ `_~c~ AY| x?X"`Ok"`'{M \#V_/׉U+0οMl?U3o_c&3IX HC{tf- ʺ"Ro d){5d'{zzz='.dMe'|i>|ooN%ɷ7V}ߗjIS>Y _E|/eb_/Ww/wW?a.+xy$P}ɻISHjIWIZ I [DO~:y<17&o"f牕KB)wt%)WiM*\ϒKJb?m[+U:h?Owӽt?=Hk9E,-ekqV]jivVWh Z JkݮjZc`P`p`h`X`x`D`d`t`Hkuֺhwkhji=MkݪviZ7BB6w EN׮תi77DOo_c%~g#~WF|,|Y> /gͥ}wY-=b>7MsTQ~s@_a|ۣ3//78Q{O{ c{3FQABgÿ_NFd sb$kz=d?~ 2_bZOyd]||\mVw?3 endstream endobj 15 0 obj << /Filter /FlateDecode /Length 101327 /Length1 207004 >> stream xx\Ź>>sޫiVҪwK-Klɶlɖܰ0alL1^@$$XILI|I&nߜ9#5#393|͜Y a>$hF̦߶윃x{yU#l)GHUִޓ>5տb˾@aF̖R8·nU}Miس5fό~ƃCڷxUZ؋Pnv%}'-Z4<ҵJBAxpaʋSEh + |>H>/\ڟh )V0,T"#מ'ZzqwnEygp(Pj~ي0}h+V[?FA~Ck{K T:<΀n, "'dG>,* !D'C T~(4Pp6oOPpe-5oq8w; 5N`aGө7V]MѥMotտs&{"!܅ߝ|p?`O- ' P_v|=A1\ X/}_ֈ@AnG9}pO>?{b):QpM3p({u#-qOy8w;2|J6xىsO=*t NUsǹq8w;sǹq8w9k>`97o;sǹq8w;s/"~7!,%:(L(\TP j@Mh:z Z!mD;O(zx2=8HF"`'m(>ZߖBmd !zQNWm>f*DM"2s7I<(&ЃвpSUŦ|`݂Ap1wo_{$=T׷l]ٽս<ʄZpˬ =#A|EH_1snCW0WW3qb9K"IO$N(.BxFBaxqAŅ8r@%9HlYt.d_<h V`NVj_I+iˡa`/v T7rcyl||Vw9ў4(~ik I>PW7WjZ͖%4 +!\Q/C#ܴ*P; DC0P4Mi<(ֳ&tUr"74Ƹ!Jk 狃pjq-AgBST1`%A*xb!V5̂puҐf^].^6 !G)o&J.Ic u/B2-$PS?zbfj14VNJYc/ L923dp zv1(sP>+Q.KBCi迨8B[ܟxFAT%SQgxioxP"*Q,PkzTF>E/xT^sOP8=?RScC4 8@Q[%Q<#T SS*b??{{wS}*G]TI4TCmT|T|p+ BTDHS머kCʫhh7WRqSq٨ĮQ"RsԺ*.v>jc/FVzzf*6Z@\DoT\@*S&޾Qbib+WQXArz2*Ҝ-R1@\L"*b! h{iS1z.M>94郺h*IE'8Q iG-;AZ2AKZh_hY?jnr9Q jF-ATATQQx {@QQ:j$MQcQc7Q\\>y ʜQ#)XYL *4t*hbTDS5-Pi&441?MG" 7.*^QQB6*TX0Sa7 BG RMTH% *TRzFTpT`*P|\G/K>|Op #Q{xn/e?ĽO7o@u|^vem[K^x?qjWkOv)r/|Ojý~ >|>x SߣG4|kApq0E՛|?Qoݧۧ1G:w7Ny;w 6 p3&!T}ת}ר~Zuo]vbߎ]uq֮mvbV֖ǭqLkS}.uᾍ]s%ܮxy6tI6X6s޷n0667]k[ۅX}ZIڷrh-V?[2ePkuо]/Yյ2xiײ}Kt Z\kaqoׂ}]v7k\?xVW׾Y]3;:utOm-]Z5v5wAQ!ɟH'ANWg%=~͛.K;qMv^/8#-^o'sܞUl[IlmYYKeNP6[0\bg|Vo?6 /8z.:#:>)k}Z|ky[\ 1$ňfƬzڧ*j.3#l+H.Wz K1#fF-c 21o_1I>seW G0gs5-䍭޵g {fvi$N8uEǂu/Hn=!g=e c=\_?v#l2.EN%퀋[[.l\XXXXX 8 0,,  y@7``6 0 0 @3 h@5 T*2@)P ( <@.   @H"0 Hɀ N`V`FZJ Rj>y08kW/_>|O?|7G]; x_# x:;W/~ x < xkӀ_$0~x81O< x08xpp0   >>?p/w.;|p;6{ p3&\ p5*n+.BU1 C1 C1 C1 C1  `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6C1 }C1} }C1} }C߶Ǐ ?  $.BOD=@v A7"^t' ݭߧ;IW! ɐƏ&IuSbnY⟌7tRG 1 {K||+_!<^Hȿx qI:@s<4>@ryh%ZBùB *%j5Et _'ȹ5Bx?&mA[ύB8I_؆.4f'Z]E3 !N=}z]IJSvw;P Is{oC$ʨDa4F~tjAt g;wbDCa`i~?,{X៣_@\ECDO5z=^@OByWz~~~ ы?#BH0v~`/64{iaR|𠵶V) rP kz =rUƦ1yRo>vͣQ{țG 8DNgq[J0Fq${*-I4Hcp䃚4uIPee$5K@y`r8\X lP`C Y$OHxTuFtN |ͭr%Vjmu W{o&,Xze-ڟʢzA~_+ȏk~(x1Pqƨy P6QΆfQ;"E'TdVFex9HQ%Nnn̵m3o+ֻR^P+tkg(*X|ݼuzJ28L:KZ=Osױ[ne$XmӋ±腒Hrԏ*➤$vJPi:8c\`$%%%%%= 1:\xOphLMiz0e MaAPhIV"P5 v=Tm`FD m6ͤ2_4sˇߟ5s$ "[%FdJ]aOC{7}~W0͕ ڼo+ }̊fH$H ?#ZB0wW?qȊTNX>'7 Q0VܭdBi ؝eJ5͕, 7U Upl{,r8\b\b\b\b\b\)9i!*BTp?wvvm̑%v4Aσ,aKER &V'@1GLYTa9KjbZ\+,~ogSJQ/S|a*۬Tүo:ܽh\cs{NR͂M5ih^o)H(("*"(ӫ%u\kK [ܩG$gl#;Ew"(K+85YeOUXv1rr=_$.IZMP&6AedD%vCڟǠVyȶd /icXڡ! N˜D[rbs "ghbrJsI:W [ۖjM;X67ۦ/OoDD;/Ӿ"_wԆŤz[P:y77'q¶iBnSF f" :a!dY 6l"3=aXsM K*7H.Ξ<ɮ4T?OYkvQ%r*qu5ENFϒ0JAфc+a?ĩê1 s8I|`дL1b3xT2A O  HOM@Ȣ$9%q \qDΠäV[riG?PjTdT<'L؞PBEb(Ѵp#[1nDWNfAmϮM6xOrHmiN^Ӎ,M%wg'ZYݶhU;%औ:Pd4cJIæڸŸdr>y:1' grb W~Soы_\RyÕu͙k-OH27\Kِp&QK-w-yޠWfL"1+G+A8K\t|p)5C2})1k=_ 7ԮW^ݒz28^VE\w:^Zz죜[I&yA2PΈ i[~ߌa @ d ,^>Iҗe%LrzZKjߋA|-JN3*7M&^xVnpN< 9^9$Q~W ;Q*iqUAS~UdDL#ܓ|=LDG&7k)GRRi]:{w~+;#R61kvO_~ӛkvYTfA yWܳ薥6+BH!_b#7֫k|fZ6Yl/g92 !nU,WZߢQ&GFHwt93B2.lDixZ1?\߁L[qc4w9 LWUbmjcҠq QIYL,Fq:$ C:Ga:RZib+BjwJ^V&e kdn8kIL3JN[=(| ZEr 4݈Dhʅ"M3>᳤Lfu)hϲDntB*F 2EǕژ*339_EBF\0iSgAT鄧k ]ƕur6f~os$T^+^Nn;>+oKO[Ǡ250 I1 4Au?`_/`rEC"#}::8+Oqk/lHɍI6gm1*Ѯ4!3%: po&74'ljaz!qWgjWT)|)^Z8fAǑ+.Orb~ 8lSVO]$U?iӡݴhZZw Oחm{鵗WW1UeC7 c|/#a#KrP1T }f,JTfp$fʊĺd؁Zx kvw˚r_fK\?U2&o`s"TX+jar{C`Lr Qc>.3G5SVf/or$x'%N5/,TGy*v6[oWXCIU֧dW/eaշk^5ǝ zT-񛯩4ˡJ1W}ȳi|&,i$HTorԡ_?珺4{f9OC^a xMr 60'{<'@T'\៴dpT1?S%Z}Ktn;id޳NBvp&D2Ӡl}Rޜi6Y&Ω4'۝"q@#ׇ!RrDi &%t0C91QIxNg70gjDw|%kb j_uW+m5|opkWD>F8??*} qr~V5m=^aw͂^>z8$F¸&#i^81a8ӎj#>(_iHr|;udV-%r4 ?ճ_1+|ځj_όḼ/jj(pC'Uz3:lϬLY] }EfЮвUBq"_(N E}1EmR+GɺF ,7sYU pZtDFFIb%@:efzHIFM0-7T_QVKIf&EjKccꢫo͟W"[j* \Zo АFQH٘/iAv L3W&ΜSx31?4?IBd%] yK\yYBq$".*GDe|.u\a]_\ma >6IlDFFQcb0] :uI^FM섹ʝ-ݱ[ v82ΤGʻJ7^̮j"No2+١3;L_ 5p9;)ѠAT/ Ft={pܶ1. %l3]GOa7}P-=utACeZ{]/ l&;fl @eQ#} S)Evd͗_>b4~JJ=O`Vp,qB uP?mN;9&U*(p֮tAZ_ytknYiuZ%79dJOdF|c춝#?riC] fk~/1&h< P + Wf29A^hdme5f>/FrA2K@"y!$u2$D@S%I'$E HbtN~R Ś̱}#J >D o‘BAr~oy|[?hijA/&޵k\{6N_q\$r,*9MZ^v:6蒺uuwܔ:XD֚ 7WBh:Z^[M }5(@ ~6UATR),o=HNUہƵznmwK|\NMhdny^ |2vGt p[wz(g43߳Z7P<vq񯒾}:Ѽi!\~NAK(#20$6;LSEJ1[e'9BDt4/ &n^mW~P3ԙ=kV]asb!_JKZ|`4& 1༜Ƙ}ŽK/hp냾9LY`z*rB@Eqٚ1/n4+S$>_ܔڳWx|Ai%pfZj<%445zgt:TOڱ6Ճ:r+fx%*MT &^q|⤵V^pfP9gZ<')e̦jZsCC4SZ/CmjWf״}{xg1TJIgܔƃCƿPe=:MYB=&T#϶wYųVo[~PÝ+&z4*֞=B }OTԤpd5eWl9UTlq Ɠ*p qXV8^с f+z^Qa^2zc* Qb!:<̩NCz6$70'.Qel)*W7Kd_Xu wWh4\޸֏rCTo;d3-M;/ּ$vtC֎@Jl%*QWbe#aANӮ5ϸnteӴ3/ݰ *2Xn<#snl',Gj7T_/xtg!9?`PW(\^fm u SH|{fwZr 똋 ^T6CQUzQz*ɨ&!h0WFzڊD% _ILU-T"dJI: J'wPUiGHh$<ټFRd>,yJ o>;ƏrCqMZUbD T=,ŰAj"q_JnJM,718nbܤ& *2kjqQҫ<4Yo>00|h+c[l{6-P&a8j:Xm\&|,Qo;gϩ˶$2\]^gtu#i;SKӬrzL\KYS]3[ mwZR|fAMP8?՗]^ߔ1Y @6J؜6s0;)RON/%օtt58*ƯA44V[R̛wRSjʬכ%m͍篨osFg_P'ՙ9'9շu6^9%%ئ;2*^|Dg[&yi82e 9괞USΰn$]I_j0n֛ b3:-&(x+yj3gWጚl;gunB6BIL!3ڌj^) .ԧśT^٫.,9ի;NX]RKVI~Ji{\3Ş)aM$&Hcf 6zG9崚#F'O\ypMUSl5RiYg|Ɓ)IT)$t'U1S=>NM!9⾋D}>дXxQ7'}@D ѣejSeXd_(wZd赱DlJϬ u k,0Q)H~ʪ#,:ԧ&*Bٍ\c.zDPLm*{$F&cySVmuLI8w3U&Rk (4Q+)xޛzz]ljC BX5-l^h^HPSꚢEŨjϤG^ 3LLʱv&ݯ@+F}BZBwwO'=:FC}11gs}4(!`ͫX(U"b«o S5놌T -uR\i[ؔ:S>kjC>KZg SRQT|530 L^1YL+EDp8~=8S%8ǥeert .W4!^&R'&:\ih76\l&[!)Tz] 2b0fl *XWz=\Y\7*쓎ƨ';d:ȧl;XS3ۋ&vLPis^kOҝuy}%+ 4dW=;)cw-c?"$ ۣT_BET9qܥTr(@Ew%|b W |?Tin8+q%vԅ ˜TT-v"N+Q`AGO_=dY8%yfiY\ޅ\ɶ( |q!M(_Ȍ,q`j,:\"1VN+YܫfBrOrqeˆ2*?JA?{}fmޟY\V}sꚢUu>ٯ5|R6L=Sp0;B-Ԗ5p<ӫКtej{K\uM)ZJeTgeڂ$j &-^-]c"!~GfFaTGUG2]ƻFdtktFD܆V2Q."F+I.t}mKt 6TfpY,.4'/>u֗6s}53*[Qђ5c>IJ68GPlƊPm?YhR'FU[=үf._?qd;Q~Ldrp;];ڲM 2rUje9ZV0kMZ#p˞u-)2ѨҙtjI% yJy$3B)@Jg#L|e`r*aۚ4SZMA[ mzYz^_23U/"!5%ߧxs)MYܟb9ڣ0Β*$<ibfV?&R_e9zMe, nsv6ߤ)gk7;ֳ}k& K3q;2*|CƝ2'7U+s*B)|sz.S̜i6^cv%9uLOO_Pho{[t97yQEȄ;QᙇrrO#QHqYxv<5$dujMq +gm^% a@h 9O(ԍ Pep{D܂dqDس/_g6 ?mL&AŤ T.TڰƬ`%UތH?9+%Ŭ?--rIQ6 vyR- %yOԑ՘jTv8k89&c Sژ+XfDcynqGvd<)^p[Яw5s`N&8P2s 0$%=M_|"Iє'J.+iX]z69;+ m\B:iǡt7-G"g~JrUd'=dÆ *v~l6{aRt!Ɩ!fML2[zynAru+3.irb1Gm7627)94pTeŒNuʴblg̑# IV:IX9C^AͤP`C*+3puئSr,Cu`^'?,_"/;JhͶrwmljJn|~Sh>4-+}Z]5CU 5;2ZV56x2= O}rDĿWDPF=h6HͺMKFN.IՎTO'6_]!Qtve5$> De|]ɩ#$hJeO,˧RDI- eVW4UK:ryZ g2[J̗V6Wՙ^[f`'Gv{j R)5Z1jZ6 :l R+A(һP.؏YTj^+9D?y)~QXNXM~M ? Sټ}߬jZ& ʟ $2)lB&$V)L%Ցq$>K&s, ՠC@-d+TfQȧMTQn)M!::44ufw~CaOyƉ( $%w PV%w>y,*{^ntYIF9w]+n'^)4r"F5m jh nbF }O!K~OUQ ><6*QْJr-hN~7oe['ŒtG%môrH-=W^(Φh$\Nl fjAo!ai|3p47ñ#Ew}$ω:#$HwMQHg dGKPQ49 KOסUIst[\eyˬaR5;F Kv).g]}/?+<)'Y"n?:9>F$Az%ߊ*!џѯMdXEyXV*c0,(F Rd{9?h-3`ȸ^:&^!kZf^ hIK^9[zOjH7Jx1^m?Viv¤ҫ,n#$W lMbɘX`OUJ/ʌqk!89 ]{?W J[yڌ'xOVzX*>x}YӍcM(dL$ '9 +@pI9 .x,.D TPTDPd]&grp{y5O穧͘>c#CmaF܈㲨aT3iЧS3Z *Lլ`4[Rqka-#zؔol%Unn{* 3̱Owd l_G.*iiwq$X"B"ZavRa2Xҧ?=D~GgLWr-J,t Q0w C[c=tЉvoj#&@2 5ؑ6+ I֭/V=QMxi_y D>op>#T-@lFTsBc9tG%7BRZ0DÆĀDbu@8=,V^~N~Rg֫DL&<+5FPtl/|{+qYUޑD̯X j0r%fsCvWeֻ;eċwZuγXe|Nʑڟ̟̟ 0 /fg8szU-+w,-ndQ5cF.?vL8Ϧ)SWΖYqo{{6.A>j)}!!Xt@cTصYَij2GE9CA+!f{vV]McƠoj5**j ^ %^'{{V~t A{r:mz:aO= jMxCOǿ5u*}ZOSY+L4hȔ@GY}Kg-:WOM+6@j 4(G34PwwQ WB~Z3FDddq$=ӽp_ulRO4s[~h2AHAZp55-W-EtI&td߼\n%MaV6Rhۧ;Wͤeݕ-ʼ/ uКJ?{I!bul议\mo_,m髉pUd/}Sug2%x }YU=S.7Fsj3ʔF;hٟf56ǮWĻ (oޘԘ#ёBlP[{U>zuޓA{j9"BaURXtj#[kg9qOǞ;A(=7g\qO?-_LiR?-7>8ٷd=KII` hdA^:q+zH&%*^7iMP PsmsN֬S;2laVCAWay(lGz>o{z,[6qֳ4KN^|l]<{*zx9(@#1|J7KqI&AR5N9'dk ~ŅFMq&ֈ0Wp\lh=lOzvҳC|=zѳ iW$ֵѱ[Ub tt")$WcbT)Suno?-ήo7\޻|B]ej }!Ʀ%]:x lF˨|9WB&5j jCBwFhcra-6=Xރ+c=dyN^ճUlB␙yecŖcF_72jW7w4,zZ"TBI mcs`#\;uh#Di1km 9Pe^PR/"C!VF\2_Lқc}l^gf9ežL=m?209'՚֚Ljf`r=$u`Zք~:5{MZ.Ιl\RXکOc6`kM 1}XP9e+W#<&=e[MȠ=KkD ^*3\췛TANϸ$,L }kvW\O>Kgi7NR{\{N{j-)u {g[EۏJ…'/5%\9]:2'''OOn91SX[?S$uI'}K+<=+9%ϝXdO=*c>QˆN & lgrNFiC~M#XM(5ƎKbs ߋ'7'gK-Kaxaa_I?> cC49&E;bYCYi0`A03S0ܰ-X+,O%_ywܐ~' ?i)ObAu}^/%U_E[Aqj20Cc҄@iNcvq.!4>x;qM܋m;W?{<"-ͲC,\,( .MiIa b|={3 ,2`/{eC1NkgFY\z} Jru<` j}\\{SdWMނ^k;VZ9q#Ƥdg)M'oW[{;`NO4ɬ\)fuoY=ؾ* snЦ}(T>UPY8ZH*DG+GT_!G!|(e4.{«/ B=TGfrD]/g2r@$0Gj#mc# XKhp$aܲI,O˖c K/H50< 9 .Q{~xƔupʁ C2"~eAa#̰ Qd~ӣ:-ylӳ1jvht*TP[VݤWURI:b] t')2_MuHa@^r8q1{D?}RtwFskWՠ&o3{uĬZ-m]{ M7o)ashc}Q1j 6fHmB, 3wtj젉s ʢX"g sy*vHc;o5iiY«FB]'Ҩih H 5.4[O WEVDd 5y5IiesA B?ĦJBb E>Oŷ4?)V&?'ވTv&4_zB4=yHV|v- 0 JfS49b5[z@&f̈6kmtT]k1G:_htZFL'$imٍZHҳ_۟VjkA۠6[ E\Q̆}Q.W{FˆȰðȰ F}ֹi }KKa I_[}uW^\AA:!6'jvQ)j 5k ja1\ ]`t?Z 688r=W/1%}vs{wۿf͉u`Aճg/A0:f5ɉ |a`"qɿW=%*ߊgr eF%&$Jo //V¯ylƻqE-8!<:= +ゟ;G>F #h=>1%huD$GMg=Xn[ }-6Ε4ͯ!tPGhLjp7%_'WRRjhw#kTtBҲ`l@?)PwI#]EiT KΎ:,g5 N'LFc-0{|^d҇8-a)kdf6N_Q1s\^(SEbbGcݍnJڠ EN/prJʎ/'SR(!T!+T9SI_UoLw\!a7$ƨ{pAԊUptFNk`BXL`NۺEmF}1m}qZoֶZ#VLz5nt^LnӶ>?b ڐ5*\c/`apP6'p.,8ٳ\Әn3}M -l!՘ԬUnU^[@)uuЕa;A~)=SݿEg6 az湪"{w1Zt8iԄXJ113ʢ8 ;WwL `z0-S-+m5 3so*JS.޽M!yhDɌ%~g9#kUmk}Ѿk':>^cpFYtItzIh2@ tknE~^W֤DH B"_kd2΁ʭYG >(#¢-hUQe f/-:bn2!PZMg$^ŋI?һ:ɘR11̓m1pW:w˟ɉ>ckczțӥQÞqݫuYm'}wsSjQ&lF)$"ٽg6 wXmOS4%84 yI0܊N!zb91j bG7nQ =Ch񺹇^$tX-vi!1*Eմ?ƹL˹w Zn+ g";ȕx`w5RL,f=FbDqZklA@NU-PX^^0pm;}}!^6dII'( kBc#92\6wwe^FgmG@\iavìÃ"Bp KXFnXtmdAJ֩1Î 94tԬy\/ 7}1Yq7J"~9 cM8g|ӟce.Cf54ag3I7295xtoɠp]2д^ ꒭㯓~#YzQR6tQ>yfN]'d/Zhk_.K"o?.w׋q-iAG1OȂeX'7V|]m42%䷋Ol=Kh ?\/aoJ n.#ED>:ZԵ:n6W$M.|]"k(gm#..~2KM;Dv7$> ~\;$$'<&g&nOܞHM>RrU9%8% 2Hu 27_7e.ndۤ:Ր_gnlsٚrլ~Yg=-dW\+箜!woKMKPHL6)/h$@}#d /"/R(=A<>g^O^E~_E~_E~_MʔU9S"{D"6HxDK$Yއt)ĉ$dbDZ26JqqqFqCH-IaWHSH 2 p=I H=]: N3Vtj)yj>J7毑ZxQH7_8v'݉" 'JGB.v;oE ;9`Q'tj;"F&4 60Amz=\=dy1jcDHʼn DHm <]"HuHwo!#7Q}hiI~]dm}Tdm(ʟYAX.~<eYJ+J?j\R4lc{%=ȏ8Yq9u9YzJ%)Q+^H[KH/%[Gl=Q,^寈WrxEұuar?99?E$:XTb % cL$ cL$;;R]ұ#%=;#R)ΈgH,)(%"$!,G AR",8 {q؋cI}$CBRv#?<y6-.(E'|R2*5d8ڷ%]GY[ [$+ߺt|&a/c&l9uJ4;uhg|"i[:QN;kH/]o]K4u$֍$HƷn#u2f]L({"˧-[W쬬+vV;+R2uu|ʺbge]YYW쬬+vV;+늝!NI2H7QMJH5$5,RX&U<-Fk$ {rCl2jVe(i)Jq(3ynpr|UV`y|r @1ʹQbl-Z-ԡZaqѥ_6J_(1wNV +9Yj.øtC~?sֵ>=J'<a#%[Dz9Y:3Vq]{pgg_8c5eqZ4mkfY{OJnۙd;1a;CL5,v|G{S/JTso`K匬Ml_l-^ -ZJG;^~o.b~Ӹmnzs>aӡk9K'kkmnf4\+PH(!ܦI(SBG:d4ާ:/W{:sYWe5fڹV>뭊껝xb޺5a-\x 9x5L}VwأRn>WfeKЂu܆m>VWqY>R*))+=2Gb0L7cUqC?Fj9NFz^:XiDY8QKy̪౫*v.dSWRE+e{^?MY[=d95?B~'9ȟ۪?.UXY]UY]\뮬Hs//wsϞS[WVSV4m`q{fq;WUW8k+jU<]ع];YS7Y]YWQꮘ]Dڲ8YRY]QV]VUV\[W]V.+.wkqgb0():;d~]y UV/FɚZ^Am^^^9ĝU%Nwf8Y*g9ggՖ`4Ö́Β:(𮝃-rVCj7ƁuU4q6rjKP -d*;WW\2ʪƕͮ+/nk<'8PǙ3kKWc067b%P]V6$&YZR]YY;*/=}ѢEiǥxzUsΪe볊qyu0bg]MNBl-PV=][[Vꜹ4qdh:%qp,R kqfj7 TYEm 4d;Y6&; 2ř+Yjj%^@g˲>QrQEyeqǓs uacRW[UW /t2sʫS觴oҲYp⚪&";]f%0&D#˸|W&by׏IR ꧖7XyaO-ʋ~jygKV+/ Dy,՗˳$ڈ 30R+Ao#1J2j!F~E&ZHKVwi.$'2r#znt'M{h8'Qb9/Vq9u+hzx'3]'%^Rz̝^}{ !popܿoJnpOlp} {/}#?ρp_/p;s={> k} g}7~/LR]F+A>g{5{~pܟ7}?{@ f!^>BwgC={`p ׃&p {3/_uNpO\p}w2g~ܽyA@pn܇ܵ=$p_Qp_wSpܽt:|i%}O2pU~? ~ϊ+`v)R>p3wHpgs}sp ?2p_ &p_;|8QЉar!L2BwpE>;pOKp'Z -ĂViUTZ*jϣ rj%OZ]oˋ57=~=ڵk/b*U][XğZE՚ kY!ÊZUjZVx=V^߰SBH8dzaKӖ-:QTkZu5dVZ:>*OSF")B>2:֭LąU ʩUr@=ѩZyd+EUmٲی3Qyٷ:󕍌 -C]jVIъMHqgqQٹnּmZNN 7?NEuhVж:Q huDuhu_(յΜ復]+R? W^4=hozhozl^%=o|HRHרFN%vS?Y Pn@oc[ZN؄zNKu?~uk4Ԩի/+fUAAb0EnWS%v4lK =k.IjcZjW_xbFYȃz/8^C6'ZJZ 0yQG7܈nG/gmA,\ُ *jx@-ObTY^$H OT<=;y_"E"oE ]F9,|~5,1wlc VpA_GijwHjR!b4LyyV `eQ>TyHS)BN41WviR=FA0:h9qѧ_E>'󌥻8#HgFj1yt;O<}x9OO|ۧ?-?+"aw:+O@ۚKh *yl#oI=e~G/*8Kؽ ~_,ޥ,w1Otڦƫwtގ輝xGa;a!S:o܊=$gp**C($+?-ߑR8Dz-uݘ55ZƩDŽŦR\ϦBY0k̗̗iaQ2m1}AM9M!y\.W,}<˄MIn"zkac}MZED =׉}}otrIt3ۂC qyr _vGXdM$߲x|)+6Qq!khic[\_{ 7'}r]YBsy"GqmRꓹOܸLH~.suy;~o!.@!)I'.'ZM~I䷒$IR)7 B Ӧ?꓿tdg}@lHSzn[suX5 }rod{~uO|{6h2!slPJcyA)5/+7l:"Kሹ\G5Q#ޅdg磪 GTG?]賣pyj>.9 |>Pӂg +<98'=5E3nɘq_;?pɓۦGL-͞2+ȶ KELU}ժUgZH 2,jkl\ |T]U@kHfh̚jfά}nRں]\^p^TJ}DG_?8f^|eqI%.yj;Ypwn;ٲ4钥o-S/_Ve]]|򧖟]~ [ĪǣƳ]X>Q"-{\~xM?tαó]Xtl%.jyֱ;!#}/ j̗BM',Mb&Z[bKٱMSsJ~\y#l?/ n qv6byKpQ8>Q,@WX va9˷E=fhcdzu%}82.|FNj~|x72rvvAjh=oc'2k*[ {g,(oM^tZ=gYE2vkx[zvITpq|T lSF7>>| Mn1}Y I!ωg.U8K}20Wc34v]| iU|>|6_QOl1VD5#u3v7hG?H8l5m@t҃s[YqyA;dԟf*-"3I(-!.ZJt{JF~bWBQϗDBY#ZQֈz^):Ot?#?uuA].|N XVq)x,_94'=ph;M 6Җ@K ;Dr/|w"|^*l [ñ5 ^,~@-yyyyyyyyyy]]]]]]ǴcZ1- ;*N'* *EK%[В-hţhţhQQV Z-urqV _/a˰YX,,-QXV< +{h`Zxc0pBܾKV 5|J&ctatatatatatatatatatL1VaC=>{} Y/}֋>Eb<ϞB=>{ },ڛ~z _3IXG1Fc B_ 3`/./"| 'Uv B*T ԏɧOߩ m'Q0[䓚H KNq@ ^D$G4I|A_Р5¾^iMo,iV$@ t0F@_ zkzkzkÀp -k_ Zq@ 2,6腼|`00r3}Qnuط X<}F3~y^U( :֡u(Ca PAa PXq ؀@@B0Yh  @$+ @d݀L r@  @/@0 À`$an1{[X`0LImdvKf9+U@X pA7ȗCF7{#c-?OVY9yO b-E/ۀFx4{pGr1d1 FPBē$D< OBē$D< OBē$D< Oz(///ۀFU`|Nzxxx 3@x4QzUU;1` pĠ^/SZ>IZ[IhͶ`tQY jpV#J_RlþFE(^77jož܇bTsNk;!}*_zN55,1Vcv5,j\\@ t$14& 5Q@4Q$I@7eb``tU.1jbЊ5^:@#`@` D a@8<O b8 &-HҰ8݁@.z#> uv +cq% rGi\jq], pn7b  <<(ІZ/A#W:n`OK+GvP9PX>d=7ZihoWSQ|`p? 0 -xx{` 8$1Y>CD0m&㚸н ^!O>^a =vJRRQ=x~0 'srje/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/tB7/t' #(`40('mC-O(FC{0U~A(&ؠ]C}+t ݷB&ݛ{toMzbN`%F~ G np-K֋V/FZ& ow]w]`wa; v2n-F˸2n-F˸2n-F˸2n-F˸2n-F˸2n-F˸2n-F˸2n8 aðaX0,p-&a"XmPxGJ"hh?y|]a`X! V|ߎzm;hXc41 k5FEFQkEFQkEFQkEFQkEFQkEFQkEFQkEF1 k5FaѰhXc4QD4 .H(l 46`C 6aп7Cf AC?ACq<!8xC+nE*E " b2Č{;32`9+U@X 6 Fbрh@l4 6 Eqрh@\4 .:@Xd?ù{OB?x})S軧wOܽw/{ ^pܽw/{ ^pܽw/{ ^pܽw/{ ^p;Y`m1iɄF/555(EYzm3hhвZ6BFh-e#lвZ6BFh-e#lвZ6BFh-e#lвZ6BFh-e#lв@^^M">{A zZjhd&}2M~>BEEEEV ЪZ5@hUjV ЪZ5@hUjV ЪZ5@hUjV ЪZ5@hUjV Ǔy?΅s 6b~zA y>~'jPH>-_Z>/<>iGaB($h']D+܍{?05`~kh eʀYl`r`>PTUj:`!K>WKa5tJxHN"Tk:C V$HK~Q6DžMu 353X+`;!€pRGH1)#|b>RGH1)#|b>RGJRr %)9HAJRr %)9HAJQEJQEJQEJQEJH))e#lR6RFJH))e#lR6RFJH))e#lR8)U!*PʐBBnTe[e[e[U[U[U[U[U[U[U[U[U[U[U[U[;eS;eS;eS;eS&33s,ѳ?L ޿EnCVAtG\s?xdp] p] p] p] p] p] p] p] p]- ׅp]Ȉ8DV "-|2x}^< G!(Dȣy"BQ< G!(Dȣy"BQ< G!(Dȣy"BQQ`0( Fa05D"XCk` !5D"XCk` !rAB$AB$AB$AB$AB$AB$AB$AB$AB$AB$AB$b|)*x(&pr(G8 Q8qp(G8 Q8qp(G8 Q8qp11111111. 1(sFʽmM{ɳ*|jl}09*)fcmֶ Kk{< q2A]4} KRaD :`^Tvݥhw)]vM)W}h_)W}W"ZԲ=uKbHinW W֭lH[1A&ν% ^ ^ ^ u^W x]+u^W x]+u^W x]+u:UNST1:UNST1{{{{{{{{{{{{A;A`0C0Yq=n 1T'ߑq~^ P6J9F.hxNד,t7FfpSXhgUHlc?ȠM_ Ol** ] EZVV UY Oy)rv*8 !se}˕a?̶̴{8d#9 b/sgxDv#ڟfm`r<-sp.@&Y e T˜@t@s@u: t|2@N`\dEe-&x L aaC00 `1 f^1^%U\1UX%UT%LUT1LT9LT9LT9LT9LTF0LT%LUT%Lԏpu S)+[Սz6H-S 2GMK4C!=]K(/h%D9BHvVv|WEz|wD2 OEZJX--OE1Nrk/x6R(sZ\Ν[>cKg w~'s;r&엪ڳ $7rW\"ڡYۼ;YKOhܽ E]'7юhf4c ؄VlC+ЈC#bh&4!&ЄHn3ۆ\_(0Ok:$k5 >d~9oqrsW#;r]'_2 p6SMŏnxK ~kLY50QC y0!a"nW0QLZ&Qh$Hh :ZUnՎAǂky"˧0S<ح l/+`X°`!%L101˃خؖ_5^[0_cgx``/a X V 6^6M+130A'>xQr 64kdn`<LFH4...~ K߅ªwÕeܗ})w2|T>W0 ^Kw).e̵R)÷[-ewV0R|E _Qq0_Ch N.Ser*ZC] r lsj6\GP(F-s[A+f9@-e엃m7i ;a7V;xo'%l%QX*p7S~Ⱦ-y!F1hhhhgrֆڂVۣ@g|^Uޡuhcq RF!QhU˗3,wv6srvNRB/b7ſ12DMjvoX,5,dZ2 -Gyx+` ׿ɹq`<[3wNT0M>k Fs |&/.!DG%ʍO\7s nA p? ~J Tq}׆z 7= (aEGbbyCmtComF(@P 堊\lo5蜍w.OK K X'= @4`!hƠ h$"҇@ k5@kw(aFOF5XsyYuY^˼S]Ou ^`Dڙ̸Tڟ`:P%>"^<_'(`wbYXrbn% Ub+XaVO,.,i2)JJҰ[K3?ɧD,<|ל'{K::"׷b";?Y?|/Q`vsZ^"­%rC?EG.b |GL~ ӛx,y3X]N|?ᩳ`' ؊nliБjl/FW֣'x֕x֕x֕L:t=^4L#Sa}3oxT<`*0LxT^*.‹baX//ƒǃ[[NaS;;;;+JWZ7 Bx4% ϒ~BB?]6]6A6-Yx,OWb+0XJ=g!5XyVgaYądn^}):A,j59?lGӑ\:k <:D3VCO 'x hdZCch|ڼfLy;\̈́.e=Uy^}S䙸,37zv{f.ׅ42غc21(<`;\oXMϷz=qoʯJuXUσ!Swdؚ|՗hm&R\I'd$'c!,"DW2os72ǍHu%9:ru[!)9:F9ü7"啞h뙰=ċl?0btjypa;3e1#,LX΄LX΄LX΄Lz*L̈́L̈́L[CC{аJP5dJۅF62 D'jC~)D39K)y|!EtDj.B#pcDj[5ѭ;F#U٪;"[!Ti."XL"v;l7Bz^%h_%INQfPUQ C#Nig3\c =ADtq}*ܗ+qξW0 o淑+%ͼWx^6 0;fV*YHo~37~eNQzɇJzȧ=_>VmVUgpz:f{>fԯօ+E-^B-9dKc1} [dLEdLӵbxJf H$ udHۑnSDSĸ$)")")")")")b<_8K2"2"2""a2y=qmgљw7[c\seU:\"x& kHirC3WV\@[ MɏM*D3Gc8p<\ Wk:op= zIh$4w;B 0 ar<m6@g/UK`4xƀUx{'g I ʗ6l-l @A)vUL%hn x@;f=lw=LBs&9Мh a=r#^kkux`| V/`%XV5 i A999b Tr~b~b~b~b^(E (:PJA(T,zpR7u[7sjܼ6%gr< Ccq,x`o&pd‘ G,}b &<`ks9rlmDA Vp>YʉBpg8G4炞r8:>B}>xtJ d?z=Oi x</K`4/ڋ OCÐ0$Dg Ht!dTj2RMVޖD0 w{}0LC0|>Og`&f0|!ՓEC\=mwp^&W8-G}d_AW%gB]$oB@B$S5§$-7|kyr\$_ma[ vhA`0C00<0L  փ0Y`O=mO 5h0|L?Vǿ ǿ ǿ [Ft~qlO~Y}} t%-n}@Gp Z҆aiðd|<FWxOah5%@.@簜77X X$( GdZ4d 4-@K m@[X-j1VZQ3h'$s< L"oɲ$n؍c7~Ə_1`,` &ƃ -6&?w{}0L A2FM'}'b߉w"Ld3q&2Dƙ8g"Ld11&2DƘc"cLda1Vc)yx#w]{:ofl1loE6ެq@Dda20@ L&da<_S<_S2@L B&! D"d2@L 셗셗%+x< G`GGGGG777777MxS?ԏ7MxS?ԏ7M,nq7E"fwc| VxV_Cu!:_Cu֏[?" e A J@)(r<}:}:}:}:}:^}(^}(^}(^}(^}(9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!rrh\ 7eH$DA"QH$DA"QH$DA"QH$DA"QH$DA"QH$DA"QHK-Zb"jE%RK̥K-1Zb++*Zb6Q&9ߨKHDhv=Ao[Q"D>Dl}hgB"hVSϧRDQN2"H[c2D&D9(glMr6Q&D9(gIGȤ#d2tL:B&!IGȤ#d2tD/}x &I`2xL===RwͥKEDQ?QOEDQ?QOEDQ?QOg:yCg:yCg:yC2WjA vl<<܋$2?B QB!UB*!LJ{6KJ!L&"1&c" T a_-R: P&l"MESQ(D~oSY,F[m:s+*#LfЃ6N}t)UG MSy6e>#(`^YCp5c/y :d=~ z¡p'dA~VP2!?CmP[8Cm!=B#dHi;lz_O4ibcP)C B4' &0rnB3_/7-j2w`w7gs&l2>&l2>&l2>&l2>&l2>&l2>&l2>&Œ+k&^)w{ʽ1?}`X A"A4 B#3Ź)9[< ς"x |*TEt0$h&)H@s@{tQ3nhpܠ\ 7d0OQIx<ρX^y^o780^WOAwpZ}Ae-Dѳl$EǮAvjUZ5ZvHCY[ݵZKJꆼX7[zBmX[۲|(`0<a`8x$`$x_fS4>3Gc |fY`6s`Zn`!X |?%` H@ 2A gv_'M6qp4b;Zn0Ɓ 3O| c0cf9`. ,` :!a+[A(@r4@cR7[֠ h NY9|<FWL5?a[-g[G 2:lװ\o=O[m0|v BnHhJZ2 ! ػ{c~ݏw0xx0$0]xLe8 p% \ ׂpu #`x<πgsyxF+`  ^7`&rvu?H_ X1ʼnM1LN e9L~S?g١~vg١~vg١~vg١~vg١~vg١~vg١~vg١~vg١~vg١~vU2fRFYԬQ ԡ;Ө;Ө;i~dݷ6r,D9Dp&RMRE)L~ S39L5CP39L5Dꠉ)I&RCLpu@: j'zQr7gɭar0C:C:C:C:C됯FW9jDOjt7hBt@922N0R@3t(OJTN-gk ŝ7t[~Ҿ'AW>2 hAq*g9'l8|jnZv?>p^yYBрs9ZKZJo2SJe)Dj^L\Hxkou%grtLve ""N9Z-3$k\Un+~>ʙ8M%mਯpTOh ` $?H6xhFw˜~KL 0 ``)SwfNޝ;5zwjݩSowE춂60-7Ho&/n2pq-*fFtVR0sZ(-Vbg;zw坁w&0b;s'wKw*Ŀf5` vnrE݁Sܭ^}eSH+iEc#ZZZqWhaƷ`|;Ʒ'Jq?x =p8H#DzlHg`:|g}s`z1z = =RXʜ~&Bt qM!t|ҧ=H\ae[ JEXp&+4ŨzFd2X$ 3UW5gW=(ihFrrcjѵgK8S#/վ*x; *' czU\ywwʙT{v.NY'{k*Z+nZ FնA;̺;wk-i#[?H|]K;A%ZחZ(RB+"i wpw-wK,Xڱ!;sw&wWi5X;.4mg|*S+_Q5]9׍JN+;CUoX[ _ ߝw.Ww|@3t9cnIKߖڹߑ.xh,M3m\ja'Wo,1\Ӂk:~'pt.\Ӎk&r=^[$2cI#qGqc0C+yson.{7;JVE ց}k?Inp-ݮZ>L=cD?+r;#/Hb'/6x^Oz-^*Omgmv-£ރ7jWJO-SOz:ѓj`9F[rJ F0S`tsuN(;s]uݸh&ͦꮹєl7L Y5.qrDW}T7IM"7dTw\ԻHGT)ʷrw\R% 88q'+q˝'+F+cX R8W N&BNNFi#*DrrSQnmbrrp{D<$) Jy$~(VHXi|V:'*'g)(gݕ=KKsK+ԫԫ 땋ԛ[ʿԻջK՞ej/r[}HR}T[}L}NY}A}Y饎Q)} [@u2X.UVjHS>Tԭ\D-UTjkuCIQ&4UӔ4S (KZ-IKRh͵JI;JYuѺ*!hX%M;A٠dkh*9ڙJvv]hj*EJDPjWi(QDMOjZQm*ǵUCPMm6^Lկ}}&j_i_6_A h mUҪ4M 3$B||F}z>OjuVW u~/>g+}|MU4z5՗QC<_ŷE+پRuW*}jooշ÷Cv>0jhMf4Z5d33vYƿ5ƍIƝƓڙƳ KcU5>MM~c1I{xxWkL5jOƗ"1{mL{XnkFH{a cimQf&TM}lv3OזgkiZ/myyѼμN3o0o677im>5{5||L+1#](]55uE%0ǘt||[obN2'Mw)z9͜77?1-1fN?43 FiJM::N::I::]::G::_׺кPϺԺ\i]i]k]oݨnnYY􇬇G0k>J!֓cs p%k>cџ^^GY㬉և yEk5S*飭JRŊY1}LO'k f_=NhOhJ&>-cBG}zmG{{{s??Og?_oOl&vNZ{WLL񽓸:m-}?moQ{l?f4Ìf3Fsy=kmfac5߷7δٟgٳ/ %b{qqqָA{2vq.51c]c4kPd@S+0 4 47FZZZo݌w##)Qgw^6>x$f`13V-cv`b`y`r=cN`jCjƢM07hӠAucPB7V#:##9ґ+i! hu\2*Q~odL1yHD9(gȮ ORa=2b/ôCyV7q{wUrPσD9Hdg^,@~?3ಷ]J\{%~ơ핻uVT0rϔrtwՓWwTacn'65w^Guӡ)5Mf ?Kfz}ATp-Zxc-v:;p73z{_k?p?:"FWnxy#x=k^wʵu^nsڡhO],;Уmw=ewT9(Ƿ~Sx؅dV2DO''}Z-FVѪ_!"QeȪ׋, "C:Qŗ{&Eg㷋.vlid;O#5O#mO#m4hC/mO/DsuQ4UM抖j6=}mJUHBkU^]}/Zi qm;D7NhEt:A(F=_@zDDJJ4ԫ i'OyvC!fhKp9g0̕42y5v;{ZEyM\"4<:a'f$D q}bhz^F䉦f{H|[Ds.BP"֎;%v הڥ\~])ZUvT1kxwS$ڵ-ni_W_MbhHE@b +@@ů5LRhz7֚6\>A$::NQwt..8;2%.wxE3 E#'5xOٟ)u@߲=>PK~0y-jl{~[z~[{~V* E@M׾J?^Vu2E/yP=/ɫ%=/yOLRjT4`6UwDC6tMM}~/ki7\}86`?}?X 4<`};z=}j}^d^^l^,4Yq:> ]y[KθM37Ft}yw{ޭ5a1}}\y?^2Cw9w{'ͧw=y:t~s9^6_,q]gy4dz}}wA ?:߷5w^35z-s?o[[kϓ.!,`g/ig|.>Ѿt)ޙ>r'_pG=s_{F%|,u>q ;/\c/?c9H+? xWϛ{w\׵?ͨt׳C/z/߲>[N5^eoʓwtKcӯ͓ȟo~畻7f~rl/ȹ.؛!+?ϴȯΏ}<'^l ^"wϧ縟~m.76ܣy)hlo eG[GwDSy;+oO!grnHԽra^,ߗ~_D9IZ~l)߭95Zi@3N1R^)/s*T'`|AGh_O}-Oz9bGo}ҽ7xd|ZsP~S&2v~N&˟j#On!n-ᆽ.K9J#wuRe,\?ʎφ}_#EKzGr0xq4Z>"ϖ!.Sߺj=7|ow(Cӎ@I{?W5 Z\F]U[tyw}eyI?kNutȎX؝9WΗ#f_W{?oWGt;wX;GB,O#ʡ{\Gl8Qns#$gpU-6{wdird*P>>gX7?To@sC{Z>),{l'a,bGdnK:?['O޷ϥTraA?퇼fu<ܨ~:,`^{gUm_eAI_O6~|8:+'տowo^_s{,k7*Nq?9]N=s33{q~YgĊ=OCz0]#w+`{x;Q 5ںO3w?5}K۽o~TD rҢI9u6ZÛ}uy"?xL9%o#kr'z΃sc,3rr dsg7ysрuN=7z ';}OǏ=4?]Ny:{"{{gΏɾydW* {׳ }_%?V{{OqOv=O_g wA¯6GRrkl>wg:Y!PbOS;yaq:g67t, 7ʳ^–uq=^bu5U=H[a`߼Ès'"y7B> C ?Fy˞-Zl)^/"ur'"[{&eoV߹][]{kebm)\7)wV_[U=xʇu|Oy:Y%Wު { owEo8%u?|*mu)LV{[you۔;X[K2HyQLPF+Lwu:]N,tWb;eF=Y=EROWkD].t"]LBdDX}L*Աb:M&rՙ"ORJlUEHMD]*rM]5UTijubfkQ5Қ sBz+ o9E뢘 s\vvVk*[U\S6v%IK[i]Mi()qWzSwWzS55Vz|zoþ,&eޛޛp{Sp{SUv(Ϲk)k)5ޔ)oʻo4w7w7%]M]MYciwu7tWwS-]c]Mm6uuSۺ뺩uԣFH=]M=]M=(0++W+׺+}ԡǩ#,RՑaV>i5OYIVj>kک[ԗkUw55w5uw5MB"u:]wM쮻Nq]S߷zSu@u:mVgYclw5u:]}M﮾.Z)"[+MZgeYz+Shm MVMlj̒ ]MʦrWeӔV 4ᨄcN$p!ጄ3 g%uJ8?b[B.IT;!+JF;5[3JxT;E;]M]M]M]M֦ uWkFi/$~x"E$BH%H !B(%ƱV;PKcƱcֱRcccyXZkcu5Z:$N3<3>k[',Ǜo?ڔNP8m_ڕWy6MqT1Ӧ*qT8m9|YTX=aS֧v?~ aeYL',446CLbe|'@;{ ;Lc *RV>%ހ u}_}_]ATcU&``TVϫPaT_WgE7U6æUgIQ~x4QV 0^ϞUOTOd3gJ{X~_>SOuNW_ QZkQUe $$Լ&K{&/7xE6I}U}M{GYHvS}ORB?_AwD$*E+բ b6 Qqb, 3,QlQ'P $\;Y|&P?IdA"0!`Ft13Q116UP>CTbtbB|抹hm8u<\;KŴ|ŽByXOObqSϊϣfXb/ėEX4.&ъvlb{VA1$Y,zKV6Elv1ghSD ]bZxG]z^p063 W+,47pv%_ao`:qF{Fc>ZxK| M =/~OZ!3w?@nq5$Ap'~VqEaT)j?CͣQ1 |B<gO'œWϠ_U%{sCH})f8acLd1 11SYALbL2{*T6,QV3=c`crcr̘:bfl~ |Gpϳ'cbpcFb31ΙXL@p& 8 g3XLl:L@p&8Lȃ3bΙ4hn'K] ΦKA v nv@p; nb9cπ}31ؗ;c_F~~63?)b1vȃisB)vgLY ,%؃څڅ,UeD""9m=5h ,MX)Fy֊6 uZ;긴.Fh=Ӥ_ـ6R,QޢmA9%]\dmTvjP[ۍ=^qUkWepPev%ﵫPg yv v-~i!M7zz}S&{TA=ƙ+sfhQLYmj[ڷpkDz;;p;q,KCJ~JwhG=:h wQ2JjMaB{$Ξ֞F;ҞA_|ߠssQΕY rKaiqq%e,;+q~}%ŭd3>Y(fٜOɜO3@i 44C|ěG3::wH:bČ+'33Bx*1DbQS QS5=jߣ=qGM{GM{&P5@{g.謁=(~O5視=/RZߓ>9N#>=)$ IМȊQxI;s.``!! `O/cſ«S`o9س`;J]q𗉅?G,X`LI,\9+#=X80C)D0EH ?b9+Y9/1n򇉑?BQO?\!11E-zPKů5G0ʦnYG<[ E6JWoy| (!ϣe*?CK #O%P׳b/TzG5JɤL(&$TK@%yR|*Ĩ @$ |b`~Tb'㟦䜾8} qNCl>4bc'SF켜xy D{0rxqr_ >%C<;uqJ ĭĭJ:4b~W&9{."\,W3'1?+׃Gr\ nW.& jkei3<"<ϒSLNy;ES g"CNy8ϑ<<)KDip ɷNL)Gq,3 gÇO>x0/2佼^X2~X.D)JbN; zX/0Xt)DEŢ{bMXtQoǧϏV2xam%WyXۦmCRm^ O!d'?YWɯx&)jj?# ox0fi/i/G L^^E ̠xi/0QQ<_؁ڏ`A0 ~bP4)6i ̠4+N7<`FܤI(Q3)p̦Xk0b ǥť,8A(`z3"OxbA^{2x_5:]#:n %kVڸȅA\M 3)raE.T1a_r95cHY= 8ll BvB !Ðc3KLq-V(:n1E'C^A&C H6$R)+(_+_3αF]/]OzH*GEH"xOA"-$($EΧ˒%K.R )Tuk>[iqKu[I~Ϻ G>_>oŊC#x ˣ"=3x)Ye5Mƌ*;(7CHGMdH$ɇ=93΁棢=flF=NұG}HrXY1=} =!] MYMRྦ pS[hXӂhC|ck5Li숈MBhL;"ѕ ɍ}|?25G Z#JM=M# M@MH*5źuMIM["oߛ \5yC DjoFjzddyIHxd2ʑpe~UVsmdйl8)Yp3'2nm GxI)\Ⱦ}s{k(jAyYy"=Wj] <Һxu3T6Zw\̏s^n{Z;)\k=ɑ^kY9zHl1GλT'"y+ts<7zzzz ƀmb/Y,17奷̧p/況`e;t w_8\Dj7`ǃiϝ`fjQs:v/N GR,RK|pN->)rI;k,A}’,ô͝KQim􂥃w%lr>I"eΨ;W[Wu"$p Nޫ!9sH8k#op0XqAK8YcH= őΓZwHLeEpwdeUp/(Y< ]n]멝MցkuuX=mxv;(φ]=y ֍-pfұ:Niqv J딌E[/(Ouܺ/ QWt e.v7 DYˀ'ÕαLV.[χEZ/Qaw]7>up?nF؎;xwv؃xwMF6M w`k E;wO!LF695ڒ+[jxMՖ^ٲÛ\+}Um-=-mȐksȀk[@$׵mu_mmm}m;mCth;Wװm8uX|׹}\c ]vv+y nGλY/vM_;]׻ː>yۓSSOo>j[m[.h/[.n/.m/h&y`{-|.t$]>oQν}!|.vi7vյ ힾnk{oAlvw,ǥQ|Lʠ+{|#wwo_ $_Ҿ&rLq2c^rGړ:N{zӾ{y|NڷK\w{uȰ{]½}iC}$=~{g+sOgw+̽,v x/Swy%AB xa\/G6rDkr>0W䑄J+37_)w"ܗ‡}}ui䱾R1kזcn,͑]6*&K~+i3@d|e4p-ac|x_7.-/ƌs"꣊¥u}!iؽt+%KE7-5Gn4V.ufRoǖڝIGd ۻsl%]b[Yx?;‡l?=V>]<5g u6#ʓ|:=|{ֽ 6Zw2n?9v:U]IZv{ mͱ[_s|wyJwМk[̶ֽٜ9{*n'ʾ{m}sNfϲmjf\ԽöyNnۮ=zfv&yG䌴Cq`7Dyw&Y$ؓ$Ӛ3Otg5suϷ7_ɲ5_ɵiS`/o{?Z] )o{*Z=5vsKBOْسmI1-=V{{KVՒ/k)ih)j))qmKETgRonfֲǾгܾ3`Ym?Yg?ҳoQƞAHN{y lt!iZz/mҲzFୖ-=2s!*1[a9- -{N:[{8RZӛ=Y-'4ܖ3\GAKK=W-W#-7zn8jZnv/Q* <:Ma]8JLFM^|Ɏ%%ٽI\{]4ѳ$7`]Rt,_RқXR֛X7ϱξ7Yٱqɼ^p% -K%%2%JВ`om֮$$߱oIGB%}F^z휥z[ޠ8LjT|ru\Hoz[K}>!n:>11%+wlKDoo轊gmJ{k$q~ɦu3*\1 n f*cDZ!q -WLdqSEb:HS<&)2T|MUV(Du,YOX}NfZBVk/^u.nM`DVƳy^df*[ȾV6~{70BX < I7)L6!Yp}BLX%Tko / ~&|Iw* ͪUDLЮzMСzCuS[BjP]jBǪ wT TTPQN ?>Nؤ$;Q- GGcbG)H3CX|N,SrZ!/ :qhV$pbH("P<%7͊J儢NxDԺٺLDwL-&(S(+o+fjgLC߉SBq/T8oa:U;MP Jao "Bߕ%*(iDe"KߑNWf*3كXXYR sϲ4f&~H+$иrdr*w]uE.®vWpkkk-f6::::::fnѭu')t,w].uWkH'vGS;q/ܫ`-Hg {{Ǒ}= <TDλB:c}Z׾!a3ޗ@2ŗLI\' 3͗:KGL_^ϙu \>)"_Hc9WzW徊"MgNY竿-t!ŹgLbYNS4];þ"M™v_C̷Kp?z|+|UJӝpso*\Dmlm$ }B}f9;<s w^]r^][_Cn|&b~Žpk :z|qOoriQIO~> J vw+џDGy=L)Կ%B~w]OH?S¯-qܕt_ bɧ_W~Jjc=vĶ˶rƹ/ yՓ1::/#cd_[>q[⍅MK6;E^|]%}7 3I~~qT@/w` /^Hv q^vҽ){{{vzf{W`Έ}v ݇u|,Gm,r gN}9v_ oh{>)g*qn 56ܔ*{F1s4&yO xؘX֘0:ϼ>=56|{$5Oi_=Ǹ^̏$lȥǸ=vd_9.#{$8v)#X}sL{F -H2j umtѸ(G98 n R90?hb88mQ9:\x;5mY#|`#6޵u/k!fE+#S} 덛xY㎠m8$ ƽo _$;>%{<<#Wm_Qk+}c!=o cxě.\89wN`<oyxË!Fs׍pp36I&7k,kwXZ^gdL][XZW)#b0J0ۢQ{u=ViuGGm“|bޓ\ez FxVςS<)@:T{X\>,F֕כ=-|G<=}6gy =\3 l ȳ%x3 O}۞!Ǟᐆ) =B:dϙPPR( <>NۡB^I*i҄ʚtJMCMIy\x{p(5{SFؔs=k yȆa CA:Wj6Bܖ7UjCMB+4CMM֦`h;ߦ.ex:s}hjZ:Ҵ&ti}ԈpGӦ٦ MC\MBךn:it(j:?@ޣxx8i:˘ >ń\fs sי7;C}_34OϘ[䴑9"EcY&[, K%>Rh)c)TZjRLbgYh^-%bx,AKg鷬lll2$8b9n9e9k^.%e5ԻI=59~G܁ ݞ=h5ƋH=hDAS9TFJm6s64ކ>DoC6z( ͤ,z:ކfc vi& ͣm6}~ǞbG*wO;Nz':މ>KDRVFDwNz'ZAD;Jz'ZEDR!jN}މ;/;їm< ?d hjUf8Fn .~X70Fi>37-2MN)lj7uVV֚6Phbn',s9Ŝn2dlfamKaQ i9(f@o&5F9zuEσp]IWb)C;qЎ!I?<&qm.}z- }0}Ҁ)S1}4/a|֧Ӭ';1X q9~f7atA0GhFŌzYƌf[B?f1fqza7e@S|w>TMfqqH2m1Ӂ{Yc[N Evic a9le_fW*쫰kq gȾomylK<`oo8wXkG'M8^دoYou#HqY Ħ󿑇ig^Uf YL0Ɇ lRs6@Z@r=g7Y فcg>#cgY)@#J&9?r+d=mGGp܈2x Tc{9bǎܵ/?i?Fd켎3g?٧Q2wdmў!|{tE:_yrrM|#gRAb%ڰ]US P&vI߫2*iUVIP5GM. v cW>TvZywǙ窰_Tu<3Gef؋Z8pz_!Nl/&e{Ƚ\}N7׍q1WxGf1k }kɧ֟J_c6Hh*-ӈ8!++zy]oՒЯs}x D?(NIh㾻k =:1۠?$=#ŸX|3Bnm9Wç@tɒ-W :-\TA %{\]")2H%VyPmƩ#կQ 8 #{@u,>uz4%=$#r$[^ X ~X S >V V ^U >U}A˲M>ޔ\{DMqK|\\&M.mn @M<X'5p9ctu٣)2kqϯ1;+Se8̾XL*$ ɃBJ ZޔaL5xo#A3 IGϬ)́CR;:~E\x!a]M;  M>sW>n;aQ iȹG>.+X\ܒr1{EHs˫i~"3[n^Fzix KAG)CcLP<a.U7Mҕu&=s|y]PU"(G˾{M#m^֡;= 3AH{!JdJHVyc\`Yӌr׳y,AY`m`m`m`mVuy1$ʲ}=wfTBe+*W.Ih"++*UrU Q *wTFݽ&Uƺ[*wP7}BM}rgQ~J:h/QhTyz.ʓYFW}J**@gfjmB5):V`.s)*r' *'EgS9]ԓ"ר4joRMOP 먎Ecd_wW<6{X0!<# |SJ5_W͉DxkTy5O>$DQ$#E.RE2$SI2d2!mxVI?kO&˄tiQʿN7ewZQ~zi){q6a yDGifRZ#df}3Q*luʯ仉d${k jpY©4T'{b}E G|Whɖ |LBwy >1|ry~'eDɟSI*)q:_o>Lv{'cGyMu&鞆`O\V1f4/ ѪZ/CmucVP'!KJ9UΕ Exx)][_{ M%Jwyl:&&UZ/]Vi:GFi|8^>Ϲ~=1z*Og9YV?/r&IVZz|)g>Ge %A5?M_Sj<\I}pd)eu, 4SYi  v~N...oTJDᥒb*X+ϳ'ߦ4q-!\~%ʿ$y; z?ѷzCjR??0,އ:Zt8'{.NК%d?O~yJMo F',kwS*hƟKQuTG?J{~5ߧXyiDu|TŭgRoNz[Oyf 4kȐ~U3 \G>jP͟S^,ŷyRI3Tn!}| i)[^MOz_YQ1oS:Dy,<a=8 ӣBHB!@G D49`2&hL"shrNlr!ݪ,~gySN:TwhU>͂W̍U^u+ /j jS^ckը@@\^j.Z[~tY`Z#- _`Q!V$CЭPARhګ.FZEB,4Ư#7Fث>HĠ{3Y# xx xvEl:8At/FxWAUeCwΦ』Tyrt 8hȰCm\ VAjUSEqzu+cvDY{RdZFf\ DoWKzZW9oYUqt Rx 赐#ByGkw@*&pBtY,H :C~~ZJ{ljETWޒ^>RJP H/`v@-8:ƨ%U{dڵŮm?|C=eS`-AE'jFڏ4FǶCv;bu-WƼ® F4;ܓX8#Ԯ\ˆ~օ\=hK-Z~%7vBޒ\6M%s-r\uT;X`lmy ݺOJgCf'=Zjo~#(=5j<m(}E)e*82E 06H;LK:v7s烡x=l,yfMZo%xpBϩŌhP`NgUR3!@CE ` BP-#) 3LSe遃_ru `7E핤%Hyp@9ZUW+UI ~0"Ԍ+FJ˨2Y[+^=e1 mfHaZeG)"O4(表"t2]V *Z^IϣpAb}Q_Cuw PWS} sT!?P?P9qdh p>Zt3C݁m3) 8+Aokmm8R=4|@7UO欤2=e1˥0/AYJZ0f'FZ-5:/^ ́ZafU3?$a(=#8^$Sٔv2>Pqt9:^ V('.!W܉@gƩ'v\map VݕWK\}2DuG4p (,B 6AFQPz\U1h¸+9nEk25nӪYNYЉ-NZ}HVt0x-! ȓ-̈́bԴAo ]Jk.͊gg[:7'&tš?ZltrKILZk,\EnKq˩nO! 0Tv*p 8ρIXt0xW oZ}PB폙`٤ⳕ')U0CPۈ>( 8*Z?^hi&qzamkȼU)T_hk?C!ʯci}v~XV=\xSJWZ!ev^'d>l0kBfpJD!Z@x6Z*@oncE@WdNv?t `+X`wر@s?VbG=Çh+`6p p |% |ǭ]Ɗ+YQNJk&R=# \\n_Z_aE'w\=Hy HnO^~mЖ_;¢|a8R5#Do&NWϘȞ0 W'YonŊS_ m+P^axW{6*!YFb1q t~*vQiCY*iTdW4{=Ywu$@(RIpsj=%H=k'K5P0o:`g'߭d6 y ֤$ٯY9P{PB\>BR{yjeP\EɪmW߀A?ջ[n!'M.*ޯh'\5OVEߖ;ɨ3 8 n=Q{5~;\%mU3P~w4cLq6wkxOUKV UQױlZMf -0L)y:XM!o os!W*[$Ҩ; ?Z{^1,U>:s;N,ZA,ZAJVVUH^*-D,TT+v]j!Y-$nз;M'%sRu_Qz#3Pl}<0*oYy/BZ*۠"0SlM"z4Џ^eOA_fyΗ8^PQ@F /UOXɊtV[ZJLm9lj݇8e!hY2Z>gea^`!`U=:Z | \1hqu=#d<kBƺo@B65SмWӰ5kucI3pXGkT* QW..1pî8{Z:ZMֈBX j` 3qhBĚ`=wF!4Vx|)zwVյfMXj)HOfUp,u9żs̔h 8 tX60vJ5s(^ꄨ_>PW(+dp8!BHfVDihе!y  Ԡ3 pp~tS}U즐J8 3{@X-Vk- qw?֚V~H?-蕠g@'@wfAݔbǢ4t} x ̅V Ac\`aŨSbDl b <hКqk\Ʈ yda>eBҚ@rԙ )P:4,S; h?_R/ځfXq׀-h, laCq@xG4fc^`!`Uro߂?m6]:GBr$ڙ bXY|``MXW hfB<hq[֫Y6'511kc='G]-|˫2Kp `'eֈBX3 j` mqh]*0=wF!4֎x|)zcukO5n Z<#La69@< Gak\:C#rT< |}w3uŝr(C[a|20aw|A[:5;*@Q0 =$q݌G3hȉo㻜; Wuqpt"hcn4PC!a{q"t_*uww%F;PTMWO{#qĺ6M|GqwWѵޖW4- JK ,${v.]u?5p%~v4;NA _~$(unzEsVPM _jPw@T4O|B^ w'CBBπQTH_~B@f$0+pJAG^+އLQN|'P FʣP*铰]-A E>(E5GBruWG5`7d (-Hb W3ZHVEWKXSkQzZʱqjQwۗyUKXn?VKբVahǛxXl*U㑽ģ5E)%ѫ^\Zn^UР̖$TVd_LUcqA2qSDzCh;WqC3~JctF];Aݛm.Jn?( :ZI {h? m?#8Q:hm 8E!X8/UXeը.2yL|ZȉkDs Ogh[0U `mHu{K$R+Z3X N-HZPygAX6|V _$%B`QQ+?=? z9eNc\]%ar5W5Z1_c\aV\K؅To~K($% AZofϬ?P-_Z#v}Q!qR|B'z9z<Hp:z;:!B.1/@އЏ@?PI <2:KŒ]z}BԷw(Է0~vQ3cU3[1JΌD︡x j߸=hK*0$_Q}pc炶jC_|_F1.'1;k YzAf,;օP\ W/I6$s;t6c3'߀[sFq:QZ!hm-G}K] : JϹh %J7Bp_4=G?mY '@?/Bop!4_'swK<*MZP j!03@@@vԻU=\X w->YYoyЛuxXd&)yTlgYj{yE ޸{6$yǦɚ6bۑ;a%*W%ի%2$&dD̒ IqR ot'H7қ "l$IҒ,$%_<)WkyH2t$I2L} #YIrI4%m#(;/#3 :I#HGR2"H[I2L"{ҏ !3e/x*UHj%5U%JrGL"eOJIUR4'䕼!#%;?Jf@r`R!ȷ$?7(=qN,K*KO] .c{#2L!]dF= !H)DHR%-$&Tҕ"p2kSc~xxP7jP`V`0qNMj&V`ƍh=C k;ǁi\||դ]ZB@ CulXviGi׹>883pp[軁'WHG 0AC 3s#wlQXX-Fk[c]=:əuG'gԲ]36nAqiNm8_)4 ndzŀQ*s -1n>8hyہ%Fǁ׀w/:udS$@ SwəF Kb5u ̀mKG.PJoR?WP^Q~ Й3+~ &~aһ9S}vFObSS{kx/"=TrPLf a1I/3‘Wjlbe+d>YCvyA5@Z֠Mh,@t MOXjV`CTmbyv.̳<[|(ʗʵVyÿ8ɹECĠ">?wxyu>?OF>o?Y_'3q^n?d婶|~!9?97~8gY#T:fFI >1=nɟIgEc}y/|"??ϙ|ڟ1 sq/O|qG$y88,(/QH4H3::Z~\ }B~.'n]}HJ'Mgї%ᢸ(N4QRZyc$G}+KpSUGKw4@){J;]Mb9wujt҇W ;3_٧81<^q0yvV^q^~9Ve$L\}.Kq&;u~"yÖiK޲%oے[J*ʧ% zx=<Qr%'Pr%L~232_dR]]Vj}NO;8r !Ov 6)MpKGOO+3L8SiyN"L"YD/l<@9x2K"\"BD )"y _(S¢0EDJxjQBiD)Q(ӊ>MDN4xzBD[іgE{ItxfYtYDWѕgEwMyvW9@1q"CP#.FQ<+DFHJ|EҊVM/ʊ$N|G2Ƣ1$$h.,hCv&bD .bE,!.$&\EC1`G CH.bI"18_LH1IL"14g+1K"E1k}>a}YUE[:.kcK6FV2a,jRoshJ=df9%S\L6 9AΓky&3{BӍpN>>q.>yT/c}z٧]|է#%v742#3$[3mL534[#m̰52l[#sl̵52[# m,5[#l,5J[#?/g&42Yojdm5Z[#mlmeMf6ۚbkfmF~5N[#l5>[#m5r![#?A#`)ۡF9jk䘭F~5򛭑FN9mk䌭sF`E[3l\5sU[3nk䆭Fnmk04r9 Koj䮭{Fy`k䡭ǶFyjk䙭F^yek䵭7Fyok$[# $ZqK3.ji,͸;#h4NY?߸Vd',^Wxsފxgޕw?8>p>Bo ʟTf^ aD8o›-wXû.2ƻ=Oӈ?ďO^O^e&.-F jaZ:-A˨eR#=zVbߛȦdn6m>Jd%{S,!Z~U-Գ%ZB V'(ev]Fғ$C34棹4SskMhI4_MzN:LJ+BZq8,|1_~?Ӹ[E[|_&K?*5K^Rj,7-|+9F BbXo˗;qs?mO]uEB=e ގ!2 "I"02uMU>'D2L&S䚟Fd&Ef92, ",`YNVGY%j%zlb3Bm쐞cMdOH?r&GQr'J9IN 9KIs\$er\%Ks 7-r!wOyL='/K&o['I TAUVUg5XM joYVc߱kh֘5aMY3֜`-Y+֚amY;֞Űl6;α. ~guvdmve}C1{žg9{^W5{޲w=gXK.H}s >*ƫ7x[ށ >St_W5|ȏc8??/̯wVX_\vJ;jvI]Ѯjk״ vKjH{=ўjϴ J{jZAKug7J%RFiQֈ2 FEkQ٨bT5ՍFMQ֨c5FCm4\~ZFhoF'#lt1݌Fi`2z}F?1h 2qc1n0Fc1oL0&c1͘n0fc1Ϙo,3+ƏO*gcXkS[hl26[6ci2v{>cq8h2G1q8i2Ng9qh\2.W5qøi2nw=xh<2O3xg7F$Nj,0cxa4^]\]=\߻z~prvqusw p t 27{?fo08s9f7G#Qhs9͜n0gs9Ϝo.0s\a442W?5Zsi2w{̽Ay%d>@du q6ĭ|_O!B< h)xt꾺/ =܎kDG551/, ˍѸ߾PFgć0+ hۤw0&ZJ=%$'Ϙ%3H`({FR;SA$ZOso^xȼ$yE1)EjQ$W-hg4>lpI'J%I?+ BI 9k^9wTX!XVpV#*558\]zz"cb(~a_DXCjOL?ha|/#e̬hVUFeTъMbT?ÿSd[4-~v2.NӨX\f*2wT[;x/oe19,qV.qNs܁ w w;;ĝʝڝNsswgpgtgrgvgqgh;.aH"|Eҿ8|μ`^2EHFEH!Ylv+QFɭl0LhZ3̴>mJ9C[Җ$mI^ڞ iO:S RH4b aY_dFlK&6Io=L~dd!Y""[x8/E#D?imvӓIiJESo74X)R]411rra 4ccXJs9;Buc888M;9.K+4ZhSG F!(J98\t3N9#t=уbb=,,C89ѣΊΊ=Euq֡' oΖΖshWczՂ^trҫ..g/e}CLfeك5rr_c=#:'M_nҗ%?O IPΑzq,cIX RV*r/aD:F]b`\Nu > `\~Wk'9]HJ1c sv%]]Hsbi$F_ƿrH2bԥ12."dT w&jDX+k(#uO>re2ڂc.>'( K](hczq@/^|dqA;&f y\ߺ%B{$r5Vx4"`Hz/$R"7!2[Mz`9'cZ2Asd~~࿓MͰ-m_`edLv%㹃9N9-e[2+1#]$%Oe; !jIJ zoT7w&GeTt r zauU>f E>)]5J.VҢ'^L^%_f2!?D8?9 !' ~Ȅr $CC~CCCo#p(Ijzè^Ѭ47-HK]4mEchqt$/:.tFwӃE;}AI`nǂXjeڍY3K]~-c}Z iaѯpEplLD;ȑJ$nu|CѡfrNNd,JUUO62$p2L'rlq09I.ʝyҒ䥑(ZIz:r(JmMZwt9 Е86?M±1]c#3Mj586sRG9(GǭP9c3(GǢt&ofn6fnfn.fnl>lfq!fnfn1fng4 ƓCAx h<O @hI q Nhiw32wh l-9l$H][BS|Z(KRWzBF}"4Px"bZBkZ[Z~C[jSǺ/:^,MSDHukkkkkkk;\;]\]{\{]\kЅCzzzw}p%M1Xs9ޜ`N4'):shn27[̭6yѼl^57[|d>1 vMq ww6wvwwNw.puG rquswptrnB  ވH)Bz>.3 2bmdԎ;:7A`>}1I1~Og33L 󖜤{o o+Vy)R)r[OI |txXK6`NkKW $e,%KDzrzc\ow;]EZNdDMD"(( "(!J(Q_4D VDgUtE_1Pĉb%Ɗb,b-bX,bX%Vb(6mb%}8$cW8%Έs₸"'x!^s%#2o2K˕H[9.~S+cU|G{4 qnq*6 e%%2ʾa߲zU1iG=#[?קO?%QO>TzG|d<#?GjO}|vOsi>11>Ȩ'?ޛ&(,gad]ԑ+t$H/JFr3,&+gN rVϋg,zCqK?4QzHq.{,rd t'Sg}kcܭ<7yI_I5}^4A6S]1MZ6E\72f~,@X"jJIt1ocu62޲lβtN/46MtI`3$=/#orz^Zj^p=JW8Zo)V,HUԯo!N闝L!3OkB}<ϧg ,NIy*ee.IX713D[BPd Rd EBP|"@(2 "@(2 yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yEBP!yE|Tw%&z:(jk5~KVoFiqg:6r9FcT][՛N}B00LI'^Ц$V;Ei?iL \q13uK~Z0j~A5~|l(cydw{zY]^R]+kjVz7:qj5ԢeۅzbFMڶo$<7Dq\ɾnٸcNņl1}F-e4F˶MsTm6&J=|^GH^*7y%3y3XgەlӢiRK^`y"sWx"3xY UoڱKMhا VOtRb(%sQtN9Ϫ~"Z˰Ê;jxjv7Τ́]tM2х[5X4sgjf?;xAMñ5Nw6me|2֮[o튭%ϖ'8Dv0:puR5rjiڛ/rNr3y,A,lKJv~.|RC$6m%7H:aa|ѧpU_h\uC6D k^3s@^eZ$WamON8l<2׏HTR:uMޭS[u#>>88bPtZ7O@7窕q=,~ڕwuo %F[[nv٥lS0WliT.)}/x1a3_Kzs̿Z.6;wȑy~Jr;Nqru ]y>Ї}aXRa艋c0݊q_mݘfe_ X5zV}G::Aևz;^u)Uq淞=U&I3rw>8+!jcFF}|se0dxlW!_f N]>c3,{"Kk OM磱J3fڷSnf-7mZsl[vWݛ;oos4WBO}֜6\g)~z)UUYqRPI׊+bIjLHVn|cWNxC$6ɐiI?xƳC;.սەّJ9^?]f\3/Ӡ73əi5o[m7zNIޜ\_m5Gϊ"6K)Kœn[~ 7kÚTUӕټ;GY?Vz٥rߩhA^_Q!޾-w>byž4fO97g?+生`EN_9zXAWơ%gT;+*WP㓀--I@j%Vb>,u;izT䥻kVtp{կ骜u/;Qr;mZPP*S.(vkO =|sgÎ?(D]6ʥuId*/{V5#@~wLa1_6%q-fKP#[:N09T <,5#8廄^W]Wv|rfCޓ7[yY;}=[zuirW8q>`^#͝1,/P, iY"]|m~O}7+?>ql tH痱Yuʔ زzO_7?DbiLmvSyF5qNZ "M2@@D@Te (MD&J@@Aԡ CH2wUww?s=ws.Ih51ٙOzd%f3shDY)3Zq ]o2o%Ƌ Z%'NT>[1[R@˔@1=$xI*i1hmWP}Z['gӟ#?q4; 7{CA"?Qܵm!#A w 5$*]ᎅ-v@hipiÏK~6LfVnj{LjPTMxU~%LVtzq{Cp1,ʞq;5uUelq(KI_ډ'3.AHC< S{,~0v,t[iZp  ኼq<S[ !zop}1Y;.a3k؍PajyK/ϕx]8g]&+O֔/Vm쮠*+/IQ+'Bn m}ITYI~&OQ5 :,1E$J$3V|YJx~F ;*-jmFG~3^#Qu`BtzNɔ:sFU{y&a)!QfbȄ93_84gdse!pnwd % spTg@ {5tUF~5{bCW{/b+xUmsŨWWJkH]ý_9Ocw a`? Ӏ>p_ w;?y "Y>FlcDxhn[Ts$?%}h&/ TtB"1wr,A  sz sap}E !$\ !t:~fp>Xڝ{aBp/PP RD0WxNvR!?m"B3bєa(?U,-{ž^oX3Dzk,ULvx?{..Zv~fKgMj Pz*SGgpmZPްȄC# \r ٳ6WH2:2(0]Fxä#M͎:EoLXz^&ѥfY[X[O|{V yV ^*>(!Q~"':I)NM5sa{Xa6.f4+|ttV%=z2?3Jzǂ#=sv6S0S'SYz rÏ9` s^Q݉t 1Wfp \E1 >uP +…G][zT CfU3C|w ,ؼ-b]dg0M ^̱FS#lxnha2:6clZ eٳF{|Puҟwo3$2A@• wj#$£AB`]x]N > d@Ж6ˆ> 97} v aGXV$`-,?Ķj7.49V4mΕCk!CVV!>~_@Om"B\;ʮvj}g4,3+qӃ-&#|&8a;]2oMKEOwDŤp+K v&aƋ toj2GF Y=s6ۥFO~1[9#2qVLl7p_sT:L{%]>eneT#%5根4*]LQ endstream endobj 5 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 658 658 658 658 658 658 658 658 220 658 658 658 220 658 658 658 658 658 658 658 658 658 658 658 658 658 658 658 658 658 658 220 285 393 619 505 889 687 236 381 381 427 553 205 332 205 490 553 553 553 553 553 553 553 553 553 553 263 263 553 553 553 422 885 623 611 562 661 575 536 610 686 324 306 629 536 815 680 653 567 653 621 496 592 647 603 921 571 570 537 350 490 350 553 370 284 488 547 440 554 487 302 494 551 277 266 524 271 832 558 530 556 546 413 429 338 552 503 774 483 503 454 387 316 387 712 658 628 658 205 302 360 751 516 516 284 1263 496 302 928 658 537 658 658 221 221 375 375 443 500 1000 284 679 429 302 818 658 454 570 220 285 440 528 543 609 316 500 284 850 416 487 553 332 850 284 375 553 407 407 284 543 587 282 284 407 427 487 865 889 865 422 623 623 623 623 623 623 866 562 575 575 575 575 324 324 324 324 664 680 653 653 653 653 653 553 653 647 647 647 647 570 573 605 488 488 488 488 488 488 752 440 487 487 487 487 277 277 277 277 530 558 530 530 530 530 530 553 530 552 552 552 552 503 547 503 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Cambria /FontDescriptor 16 0 R >> endobj 16 0 obj << /Type /FontDescriptor /Ascent 778 /CapHeight 0 /Descent -222 /Flags 32 /FontBBox [ -1475 -2464 2868 3117 ] /FontName /ABCDEE+Cambria /ItalicAngle 0 /StemV 0 /FontFile2 14 0 R >> endobj 6 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 400 498 506 714 682 220 303 303 498 498 249 306 252 386 506 506 506 506 506 506 506 506 506 506 267 267 498 498 498 463 894 578 543 533 615 488 459 630 623 251 318 519 420 854 645 662 516 672 542 459 487 641 567 889 519 487 468 306 386 306 498 498 291 479 525 422 525 497 305 470 525 229 239 454 229 798 525 527 525 525 348 391 334 525 451 714 433 452 395 314 460 314 498 506 506 506 249 305 418 690 498 498 395 1038 459 338 866 506 468 506 506 249 249 418 418 498 498 905 450 705 391 338 849 506 395 487 226 325 498 506 498 506 498 498 392 834 402 512 498 306 506 394 338 498 335 334 291 549 585 252 307 246 422 512 636 671 675 463 578 578 578 578 578 578 763 533 488 488 488 488 251 251 251 251 624 645 662 662 662 662 662 498 663 641 641 641 641 487 516 527 479 479 479 479 479 479 772 422 497 497 497 497 229 229 229 229 525 525 527 527 527 527 527 498 529 525 525 525 525 452 525 452 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri /FontDescriptor 17 0 R >> endobj 17 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 15 0 R >> endobj 9 0 obj << /Type /Font /Subtype /Type0 /BaseFont /ABCDEE+Calibri /Encoding /Identity-H /DescendantFonts [18 0 R] >> endobj 18 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /ABCDEE+Calibri /CIDSystemInfo << /Registry (Adobe) /Ordering (Identity) /Supplement 0 >> /W [3 [226.074] 69 [645.508] 122 [487.305] 258 [479.004] 271 [525.391] 272 [422.852] 286 [497.559] 336 [470.703] 349 [229.492] 364 [454.59] 367 [229.492] 373 [798.828] 374 [525.391] 381 [527.344] 396 [348.633] 449 [714.844] 856 [252.441] 882 [306.152] 894 [303.223] 895 [303.223] 1004 [506.836] 1005 [506.836] 1006 [506.836] 1008 [506.836] 1009 [506.836] 1085 [498.047] ] /FontDescriptor 19 0 R >> endobj 19 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 15 0 R >> endobj 13 0 obj << /Type /Pages /Kids [ 2 0 R ] /Count 1 >> endobj 20 0 obj << /Type /Catalog /Pages 13 0 R >> endobj 21 0 obj << /Title /Author <> /Subject <> /Creator (Microsoft Reporting Services 12.0.0.0) /Producer (Microsoft Reporting Services PDF Rendering Extension 12.0.0.0) /CreationDate (D:20181121070256-06'00') >> endobj xref 0 22 0000000000 65535 f 0000000010 00000 n 0000001019 00000 n 0000001281 00000 n 0000013103 00000 n 0000245203 00000 n 0000246599 00000 n 0000000831 00000 n 0000013338 00000 n 0000247990 00000 n 0000014593 00000 n 0000025436 00000 n 0000000065 00000 n 0000248871 00000 n 0000032248 00000 n 0000143777 00000 n 0000246397 00000 n 0000247790 00000 n 0000248116 00000 n 0000248671 00000 n 0000248934 00000 n 0000248988 00000 n trailer << /Size 22 /Root 20 0 R /Info 21 0 R >> startxref 249295 %%EOF